Rorug03G0009400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
OG0003540
Physical Location & Seq
Forward (+)
696549 .. 696956
408 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0009400.1

Sequence Viewer

Length: 408 bp
ATGAAGCTGGGACAAATTTACTGTGTTGTCTTGCTCATTGCTCTAGCCTTCGGTTCAAGCAATGCATTGATAAACTTTCCTGGGACAAAGAAATTTGTTCGCATCGTCAACAATCTGAACAACGGAGAAAGACTTAATCTTCGTTGTCAATCTAAAGATGATGATCTTGGTGTTCACAGTCTTGTTGTCAATGAGCAATACGAATTTAGCTTTCGGATCAACATCTGGAGAAACACACTTTTCTTTTGCCGTTTATGGTATTCGGACAAGCATACAGAATTTGTTGCATTTAAAGTTAGTCTTGGTTTTTATACAGATTGTGGCAATCAAGATCATTGCATATGGACAGCCAAAGAGGATGGAGTATACTTGAAAGATAAATTGCAATATTTTTGGGTAAAAAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

135

Amino Acids

15.82

Weight (kDa)

8.6

Isoelectric Point (pI)

16.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 33 - 127 8.6e-29 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 366
AclWI GGATC 1 cut(s) 224
AcsI RAATTY 4 cut(s) 15, 92, 203, 278
AgsI TTSAA 2 cut(s) 57, 373
AjnI CCWGG 1 cut(s) 79
AluBI AGCT 2 cut(s) 7, 210
AluI AGCT 2 cut(s) 7, 210
AlwI GGATC 1 cut(s) 224
ApoI RAATTY 4 cut(s) 15, 92, 203, 278
ArsI GACNNNNNNTTYG 2 cut(s) 123, 155
BccI CCATC 1 cut(s) 353
BceAI ACGGC 1 cut(s) 234
BciT130I CCWGG 1 cut(s) 81
BfaI CTAG 1 cut(s) 44
Bme1390I CCNGG 1 cut(s) 81
BmrFI CCNGG 1 cut(s) 81
BmsI GCATC 1 cut(s) 111
BpmI CTGGAG 1 cut(s) 247
BsaBI GATNNNNATC 2 cut(s) 162, 221
BsaJI CCNNGG 1 cut(s) 80
Bse3DI GCAATG 3 cut(s) 36, 67, 334
Bse8I GATNNNNATC 2 cut(s) 162, 221
BseBI CCWGG 1 cut(s) 81
BseDI CCNNGG 1 cut(s) 80
BseGI GGATG 1 cut(s) 364
BseJI GATNNNNATC 2 cut(s) 162, 221
BseMI GCAATG 3 cut(s) 36, 67, 334
BseYI CCCAGC 1 cut(s) 7
BslFI GGGAC 2 cut(s) 24, 97
BsmFI GGGAC 2 cut(s) 24, 97
Bsp143I GATC 3 cut(s) 163, 216, 331
BspPI GGATC 1 cut(s) 224
BsrDI GCAATG 3 cut(s) 36, 67, 334
BssECI CCNNGG 1 cut(s) 80
BssMI GATC 3 cut(s) 163, 216, 331
BssNAI GTATAC 1 cut(s) 367
Bst1107I GTATAC 1 cut(s) 367
Bst2UI CCWGG 1 cut(s) 81
Bst4CI ACNGT 2 cut(s) 23, 179
BstF5I GGATG 1 cut(s) 364
BstKTI GATC 3 cut(s) 166, 219, 334
BstMBI GATC 3 cut(s) 163, 216, 331
BstNI CCWGG 1 cut(s) 81
BstSCI CCNGG 1 cut(s) 79
BstZ17I GTATAC 1 cut(s) 367
BtsCI GGATG 1 cut(s) 364
CviJI RGCY 4 cut(s) 7, 47, 210, 350
CviKI_1 RGCY 4 cut(s) 7, 47, 210, 350
DpnI GATC 3 cut(s) 165, 218, 333
DpnII GATC 3 cut(s) 163, 216, 331
DraI TTTAAA 1 cut(s) 292
EcoRII CCWGG 1 cut(s) 79
EcoT22I ATGCAT 1 cut(s) 67
FaiI YATR 6 cut(s) 256, 273, 312, 341, 343, 367
FalI AAGNNNNNCTT 2 cut(s) 285, 317
FaqI GGGAC 2 cut(s) 24, 97
FauNDI CATATG 1 cut(s) 341
FblI GTMKAC 1 cut(s) 366
FokI GGATG 1 cut(s) 371
FspBI CTAG 1 cut(s) 44
GsaI CCCAGC 1 cut(s) 11
GsuI CTGGAG 1 cut(s) 247
HincII GTYRAC 1 cut(s) 109
HindII GTYRAC 1 cut(s) 109
Hpy166II GTNNAC 3 cut(s) 109, 175, 367
Hpy188I TCNGA 3 cut(s) 117, 216, 265
Hpy188III TCNNGA 2 cut(s) 226, 329
Hpy8I GTNNAC 3 cut(s) 109, 175, 367
HpyAV CCTTC 1 cut(s) 58
HpyCH4III ACNGT 2 cut(s) 23, 179
HpyCH4V TGCA 4 cut(s) 65, 287, 339, 385
Kzo9I GATC 3 cut(s) 163, 216, 331
LpnPI CCDG 3 cut(s) 66, 93, 211
LweI GCATC 1 cut(s) 111
MaeI CTAG 1 cut(s) 44
MalI GATC 3 cut(s) 165, 218, 333
MboI GATC 3 cut(s) 163, 216, 331
MboII GAAGA 1 cut(s) 131
MluCI AATT 6 cut(s) 15, 92, 203, 278, 380, 403
MnlI CCTC 1 cut(s) 349
Mph1103I ATGCAT 1 cut(s) 67
MseI TTAA 2 cut(s) 135, 291
MspR9I CCNGG 1 cut(s) 81
MvaI CCWGG 1 cut(s) 81
NdeI CATATG 1 cut(s) 341
NdeII GATC 3 cut(s) 163, 216, 331
NsiI ATGCAT 1 cut(s) 67
Psp6I CCWGG 1 cut(s) 79
PspFI CCCAGC 1 cut(s) 7
PspGI CCWGG 1 cut(s) 79
SaqAI TTAA 2 cut(s) 135, 291
Sau3AI GATC 3 cut(s) 163, 216, 331
ScrFI CCNGG 1 cut(s) 81
SetI ASST 2 cut(s) 9, 212
SfaNI GCATC 1 cut(s) 111
Sse9I AATT 6 cut(s) 15, 92, 203, 278, 380, 403
SspI AATATT 1 cut(s) 389
SspMI CTAG 1 cut(s) 44
StyD4I CCNGG 1 cut(s) 79
TaaI ACNGT 2 cut(s) 23, 179
TasI AATT 6 cut(s) 15, 92, 203, 278, 380, 403
Tru1I TTAA 2 cut(s) 135, 291
Tru9I TTAA 2 cut(s) 135, 291
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 138
XapI RAATTY 4 cut(s) 15, 92, 203, 278
XmiI GTMKAC 1 cut(s) 366
XspI CTAG 1 cut(s) 44
Zsp2I ATGCAT 1 cut(s) 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.