RchiOBHm_Chr2g0091411

gal1,galk

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0005927
Physical Location & Seq
Forward (+)
5082060 .. 5083882
1823 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ46659

Sequence Viewer

Length: 267 bp
ATGGCTCAAATGATGAGCCACGAAGAACTACCGATCCGAATCCACTTCGCTATCGACGAAGTCTACGACGATCCCTCGCAACTCGAGGAGGCCCAGCTCCGTTTACACCACCTCAAGACCAAGTTTCACAAGGTCTTCGGGCACCTTCCTCAAGTCTGCGCTCGCTCTCCAGGGAGAGTGAATTTTATTGGAGAGCATACAGACTATGACGGATTCTCGGTGTTGCCGATGGCGATACGGCAGGATATATACTATTGTGGCGATTAG

Protein Analysis

88

Amino Acids

10.24

Weight (kDa)

5.72

Isoelectric Point (pI)

55.37

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GalKase_gal_bdg PF10509 41 - 85 9.4e-21 Galactokinase galactose-binding signature
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 141
AccI GTMKAC 1 cut(s) 63
AclWI GGATC 2 cut(s) 28, 65
AcsI RAATTY 1 cut(s) 181
AjnI CCWGG 1 cut(s) 169
AloI GAACNNNNNNTCC 2 cut(s) 18, 50
AluBI AGCT 1 cut(s) 97
AluI AGCT 1 cut(s) 97
AlwI GGATC 2 cut(s) 28, 65
Ama87I CYCGRG 1 cut(s) 83
AoxI GGCC 1 cut(s) 90
ApoI RAATTY 1 cut(s) 181
AspLEI GCGC 1 cut(s) 161
AspS9I GGNCC 1 cut(s) 91
AvaI CYCGRG 1 cut(s) 83
BaeGI GKGCMC 1 cut(s) 144
BanI GGYRCC 1 cut(s) 141
BbsI GAAGAC 1 cut(s) 127
BccI CCATC 1 cut(s) 223
BceAI ACGGC 1 cut(s) 254
BciT130I CCWGG 1 cut(s) 171
Bme1390I CCNGG 1 cut(s) 171
BmeT110I CYCGRG 1 cut(s) 83
BmgT120I GGNCC 1 cut(s) 91
BmiI GGNNCC 1 cut(s) 143
BmrFI CCNGG 1 cut(s) 171
BpiI GAAGAC 1 cut(s) 127
BpmI CTGGAG 1 cut(s) 153
BpuEI CTTGAG 2 cut(s) 98, 135
BsaBI GATNNNNATC 1 cut(s) 38
BsaJI CCNNGG 1 cut(s) 170
Bse8I GATNNNNATC 1 cut(s) 38
BseBI CCWGG 1 cut(s) 171
BseDI CCNNGG 1 cut(s) 170
BseJI GATNNNNATC 1 cut(s) 38
BseRI GAGGAG 1 cut(s) 101
BseSI GKGCMC 1 cut(s) 144
BseYI CCCAGC 1 cut(s) 93
BshFI GGCC 1 cut(s) 92
BshNI GGYRCC 1 cut(s) 141
BsiHKCI CYCGRG 1 cut(s) 83
BsnI GGCC 1 cut(s) 92
BsoBI CYCGRG 1 cut(s) 83
Bsp1286I GDGCHC 1 cut(s) 144
Bsp143I GATC 2 cut(s) 33, 70
BspANI GGCC 1 cut(s) 92
BspLI GGNNCC 1 cut(s) 143
BspPI GGATC 2 cut(s) 28, 65
BspT107I GGYRCC 1 cut(s) 141
BssECI CCNNGG 1 cut(s) 170
BssMI GATC 2 cut(s) 33, 70
Bst2UI CCWGG 1 cut(s) 171
BstC8I GCNNGC 1 cut(s) 163
BstHHI GCGC 1 cut(s) 161
BstKTI GATC 2 cut(s) 36, 73
BstMBI GATC 2 cut(s) 33, 70
BstNI CCWGG 1 cut(s) 171
BstSCI CCNGG 1 cut(s) 169
BstSLI GKGCMC 1 cut(s) 144
BstV2I GAAGAC 1 cut(s) 127
BsuRI GGCC 1 cut(s) 92
Cac8I GCNNGC 1 cut(s) 163
CfoI GCGC 1 cut(s) 161
Cfr13I GGNCC 1 cut(s) 91
CviJI RGCY 4 cut(s) 5, 18, 92, 97
CviKI_1 RGCY 4 cut(s) 5, 18, 92, 97
DpnI GATC 2 cut(s) 35, 72
DpnII GATC 2 cut(s) 33, 70
Eco88I CYCGRG 1 cut(s) 83
EcoRII CCWGG 1 cut(s) 169
FaiI YATR 4 cut(s) 198, 207, 248, 250
FblI GTMKAC 1 cut(s) 63
GlaI GCGC 1 cut(s) 160
GsaI CCCAGC 1 cut(s) 97
GsuI CTGGAG 1 cut(s) 153
HaeIII GGCC 1 cut(s) 92
HhaI GCGC 1 cut(s) 161
Hin6I GCGC 1 cut(s) 159
HinP1I GCGC 1 cut(s) 159
HinfI GANTC 2 cut(s) 39, 213
Hpy166II GTNNAC 2 cut(s) 64, 104
Hpy188I TCNGA 1 cut(s) 38
Hpy188III TCNNGA 1 cut(s) 115
Hpy8I GTNNAC 2 cut(s) 64, 104
Hpy99I CGWCG 2 cut(s) 59, 71
HpyAV CCTTC 1 cut(s) 155
HspAI GCGC 1 cut(s) 159
Kzo9I GATC 2 cut(s) 33, 70
LmnI GCTCC 1 cut(s) 102
LpnPI CCDG 4 cut(s) 107, 156, 183, 227
MalI GATC 2 cut(s) 35, 72
MboI GATC 2 cut(s) 33, 70
MboII GAAGA 2 cut(s) 35, 127
MhlI GDGCHC 1 cut(s) 144
MluCI AATT 1 cut(s) 181
MnlI CCTC 5 cut(s) 79, 82, 85, 122, 159
MspR9I CCNGG 1 cut(s) 171
MvaI CCWGG 1 cut(s) 171
NdeII GATC 2 cut(s) 33, 70
NlaIV GGNNCC 1 cut(s) 143
PaeR7I CTCGAG 1 cut(s) 83
PcsI WCGNNNNNNNCGW 3 cut(s) 54, 63, 224
PfeI GAWTC 2 cut(s) 39, 213
PflFI GACNNNGTC 1 cut(s) 59
Psp6I CCWGG 1 cut(s) 169
PspFI CCCAGC 1 cut(s) 93
PspGI CCWGG 1 cut(s) 169
PspN4I GGNNCC 1 cut(s) 143
PspPI GGNCC 1 cut(s) 91
PspXI VCTCGAGB 1 cut(s) 83
PsyI GACNNNGTC 1 cut(s) 59
Sau3AI GATC 2 cut(s) 33, 70
Sau96I GGNCC 1 cut(s) 91
ScrFI CCNGG 1 cut(s) 171
SduI GDGCHC 1 cut(s) 144
SetI ASST 4 cut(s) 99, 114, 135, 147
Sfr274I CTCGAG 1 cut(s) 83
SlaI CTCGAG 1 cut(s) 83
SmlI CTYRAG 3 cut(s) 83, 113, 150
SmoI CTYRAG 3 cut(s) 83, 113, 150
Sse9I AATT 1 cut(s) 181
StyD4I CCNGG 1 cut(s) 169
TaqI TCGA 2 cut(s) 54, 84
TasI AATT 1 cut(s) 181
TfiI GAWTC 2 cut(s) 39, 213
TspGWI ACGGA 2 cut(s) 89, 225
Tth111I GACNNNGTC 1 cut(s) 59
XapI RAATTY 1 cut(s) 181
XhoI CTCGAG 1 cut(s) 83
XmiI GTMKAC 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.