Rh4CG006700

gal1,galk

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
1290647 .. 1290859
213 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG006700.1

Sequence Viewer

Length: 213 bp
ATGGCTCAAATGATGAGCCACGAAGAACTCCCGATGGGGAAGGGTATCTTCTTCTACGACGATCCCTCGCAACTCGAGGAGGCCCAGCTACGCTTACACCGCCTCAAGACCAAGTTTCACAAGGTCTTCGGGCACCTTCCTCAAGTCTACGCTCGCTCTCCAGGTTTGTTATCTATCTCTCTATCTCTTTGTGGTTTGGTTCTATGTGTTTGA

Protein Analysis

70

Amino Acids

7.94

Weight (kDa)

7.86

Isoelectric Point (pI)

60.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 132
AccI GTMKAC 1 cut(s) 147
AciI CCGC 1 cut(s) 100
AclWI GGATC 1 cut(s) 56
AjnI CCWGG 1 cut(s) 160
AluBI AGCT 1 cut(s) 88
AluI AGCT 1 cut(s) 88
AlwI GGATC 1 cut(s) 56
Ama87I CYCGRG 1 cut(s) 74
AoxI GGCC 1 cut(s) 81
AspS9I GGNCC 1 cut(s) 82
AvaI CYCGRG 1 cut(s) 74
BaeGI GKGCMC 1 cut(s) 135
BanI GGYRCC 1 cut(s) 132
BbsI GAAGAC 1 cut(s) 118
BccI CCATC 1 cut(s) 28
BciT130I CCWGG 1 cut(s) 162
Bme1390I CCNGG 1 cut(s) 162
BmeT110I CYCGRG 1 cut(s) 74
BmgT120I GGNCC 1 cut(s) 82
BmiI GGNNCC 1 cut(s) 134
BmrFI CCNGG 1 cut(s) 162
BpiI GAAGAC 1 cut(s) 118
BpmI CTGGAG 1 cut(s) 144
BpuEI CTTGAG 2 cut(s) 89, 126
BseBI CCWGG 1 cut(s) 162
BseRI GAGGAG 1 cut(s) 92
BseSI GKGCMC 1 cut(s) 135
BseYI CCCAGC 1 cut(s) 84
BshFI GGCC 1 cut(s) 83
BshNI GGYRCC 1 cut(s) 132
BsiHKCI CYCGRG 1 cut(s) 74
BsnI GGCC 1 cut(s) 83
BsoBI CYCGRG 1 cut(s) 74
Bsp1286I GDGCHC 1 cut(s) 135
Bsp143I GATC 1 cut(s) 61
BspACI CCGC 1 cut(s) 100
BspANI GGCC 1 cut(s) 83
BspLI GGNNCC 1 cut(s) 134
BspPI GGATC 1 cut(s) 56
BspT107I GGYRCC 1 cut(s) 132
BssMI GATC 1 cut(s) 61
Bst2UI CCWGG 1 cut(s) 162
BstC8I GCNNGC 1 cut(s) 154
BstKTI GATC 1 cut(s) 64
BstMBI GATC 1 cut(s) 61
BstMWI GCNNNNNNNGC 1 cut(s) 99
BstNI CCWGG 1 cut(s) 162
BstSCI CCNGG 1 cut(s) 160
BstSLI GKGCMC 1 cut(s) 135
BstV2I GAAGAC 1 cut(s) 118
BsuRI GGCC 1 cut(s) 83
Cac8I GCNNGC 1 cut(s) 154
Cfr13I GGNCC 1 cut(s) 82
CviJI RGCY 4 cut(s) 5, 18, 83, 88
CviKI_1 RGCY 4 cut(s) 5, 18, 83, 88
DpnI GATC 1 cut(s) 63
DpnII GATC 1 cut(s) 61
Eco88I CYCGRG 1 cut(s) 74
EcoRII CCWGG 1 cut(s) 160
FaiI YATR 1 cut(s) 205
FalI AAGNNNNNCTT 2 cut(s) 32, 64
FblI GTMKAC 1 cut(s) 147
GsaI CCCAGC 1 cut(s) 88
GsuI CTGGAG 1 cut(s) 144
HaeIII GGCC 1 cut(s) 83
Hpy166II GTNNAC 1 cut(s) 148
Hpy188III TCNNGA 2 cut(s) 31, 106
Hpy8I GTNNAC 1 cut(s) 148
Hpy99I CGWCG 1 cut(s) 62
HpyAV CCTTC 2 cut(s) 34, 146
HpyF10VI GCNNNNNNNGC 1 cut(s) 99
Kzo9I GATC 1 cut(s) 61
LpnPI CCDG 3 cut(s) 98, 147, 174
MalI GATC 1 cut(s) 63
MboI GATC 1 cut(s) 61
MboII GAAGA 4 cut(s) 35, 40, 43, 118
MhlI GDGCHC 1 cut(s) 135
MnlI CCTC 5 cut(s) 70, 73, 76, 113, 150
MspR9I CCNGG 1 cut(s) 162
MvaI CCWGG 1 cut(s) 162
MwoI GCNNNNNNNGC 1 cut(s) 99
NdeII GATC 1 cut(s) 61
NlaIV GGNNCC 1 cut(s) 134
PaeR7I CTCGAG 1 cut(s) 74
Psp6I CCWGG 1 cut(s) 160
PspFI CCCAGC 1 cut(s) 84
PspGI CCWGG 1 cut(s) 160
PspN4I GGNNCC 1 cut(s) 134
PspPI GGNCC 1 cut(s) 82
PspXI VCTCGAGB 1 cut(s) 74
Sau3AI GATC 1 cut(s) 61
Sau96I GGNCC 1 cut(s) 82
ScrFI CCNGG 1 cut(s) 162
SduI GDGCHC 1 cut(s) 135
SetI ASST 4 cut(s) 90, 126, 138, 166
Sfr274I CTCGAG 1 cut(s) 74
SlaI CTCGAG 1 cut(s) 74
SmlI CTYRAG 3 cut(s) 74, 104, 141
SmoI CTYRAG 3 cut(s) 74, 104, 141
SsiI CCGC 1 cut(s) 100
StyD4I CCNGG 1 cut(s) 160
TaqI TCGA 1 cut(s) 75
XhoI CTCGAG 1 cut(s) 74
XmiI GTMKAC 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.