Rh2CG508300

Required for maturation of ribosomal RNAs and formation of the large ribosomal subunit

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
68042425 .. 68043105
681 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG508300.1

Sequence Viewer

Length: 234 bp
ATGAAAAGTGGTTCTTCCGAAAATGAGGTTGCTCCTCGAAATACAATAGGTGCTAATACAATTGGTGTTGTTCCTTTGGATTGGTATCGGGATGAGAAACGTATTGGTTATGATCTTACAGTGAAGAAGATTAAAAGGAAGGAAAGAGAAGACAGATTGCAATCCTTTCTTGCTAATGCTGATGATTCCAAAATTTGGTGGGTTTTAGTTTCTAAGATGATATCTATCAATTGA

Protein Analysis

77

Amino Acids

8.88

Weight (kDa)

9.39

Isoelectric Point (pI)

37.75

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
BOP1NT PF08145 29 - 70 4.2e-08 BOP1NT (NUC169) domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 195
AcsI RAATTY 1 cut(s) 192
AfiI CCNNNNNNNGG 1 cut(s) 195
ApoI RAATTY 1 cut(s) 192
BbsI GAAGAC 1 cut(s) 156
BpiI GAAGAC 1 cut(s) 156
BsaBI GATNNNNATC 3 cut(s) 84, 160, 224
Bsc4I CCNNNNNNNGG 1 cut(s) 195
Bse8I GATNNNNATC 3 cut(s) 84, 160, 224
BseGI GGATG 1 cut(s) 97
BseJI GATNNNNATC 3 cut(s) 84, 160, 224
BseLI CCNNNNNNNGG 1 cut(s) 195
BseRI GAGGAG 1 cut(s) 24
BslI CCNNNNNNNGG 1 cut(s) 195
Bsp143I GATC 1 cut(s) 112
BssMI GATC 1 cut(s) 112
Bst4CI ACNGT 1 cut(s) 121
BstDEI CTNAG 1 cut(s) 213
BstF5I GGATG 1 cut(s) 97
BstKTI GATC 1 cut(s) 115
BstMBI GATC 1 cut(s) 112
BstV2I GAAGAC 1 cut(s) 156
BtsCI GGATG 1 cut(s) 97
BtsIMutI CAGTG 1 cut(s) 126
DdeI CTNAG 1 cut(s) 213
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
Eco32I GATATC 1 cut(s) 222
EcoRV GATATC 1 cut(s) 222
FaiI YATR 1 cut(s) 111
FalI AAGNNNNNCTT 1 cut(s) 30
FokI GGATG 1 cut(s) 104
HinfI GANTC 1 cut(s) 185
Hpy188I TCNGA 1 cut(s) 19
Hpy188III TCNNGA 1 cut(s) 89
HpyAV CCTTC 1 cut(s) 133
HpyCH4III ACNGT 1 cut(s) 121
HpyCH4IV ACGT 1 cut(s) 100
HpyCH4V TGCA 1 cut(s) 160
HpyF3I CTNAG 1 cut(s) 213
HpySE526I ACGT 1 cut(s) 100
Kzo9I GATC 1 cut(s) 112
LmnI GCTCC 1 cut(s) 37
MaeII ACGT 1 cut(s) 100
MalI GATC 1 cut(s) 114
MboI GATC 1 cut(s) 112
MboII GAAGA 4 cut(s) 6, 136, 139, 161
MfeI CAATTG 2 cut(s) 60, 229
MluCI AATT 3 cut(s) 60, 192, 229
MnlI CCTC 2 cut(s) 19, 45
MseI TTAA 1 cut(s) 132
MunI CAATTG 2 cut(s) 60, 229
NdeII GATC 1 cut(s) 112
PfeI GAWTC 1 cut(s) 185
PflMI CCANNNNNTGG 1 cut(s) 195
SaqAI TTAA 1 cut(s) 132
Sau3AI GATC 1 cut(s) 112
SetI ASST 3 cut(s) 30, 52, 103
SgeI CNNG 3 cut(s) 48, 101, 182
Sse9I AATT 3 cut(s) 60, 192, 229
TaaI ACNGT 1 cut(s) 121
TaiI ACGT 1 cut(s) 103
TaqI TCGA 1 cut(s) 37
TasI AATT 3 cut(s) 60, 192, 229
TfiI GAWTC 1 cut(s) 185
Tru1I TTAA 1 cut(s) 132
Tru9I TTAA 1 cut(s) 132
TscAI CASTG 1 cut(s) 126
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 126
Van91I CCANNNNNTGG 1 cut(s) 195
XapI RAATTY 1 cut(s) 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.