RchiOBHm_Chr2g0119751

Egg cell-secreted protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0008373
Physical Location & Seq
Reverse (-)
32322279 .. 32322587
309 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49244

Sequence Viewer

Length: 309 bp
ATGCAACTGCTACTAGGAAAATTTCTGCTAGTGGAATGCGGAAATGCACTGGTGGAGCTGAAATGTTGCTCGCAAGAGATTGTTGTGTATTTCCTGAATGGGAAGGCTAATATCGGTCCAGACTGTTGCAAAGCTATCGCCACCATTACACGCCACTGCTGGCCTGTAATGCTTACTTCCCTTGGCTTCACTGCAGAACAAGGTGACGTCTTACGAGGCTACTGTGATGCTGCGGCTGCTGTGACTACTACTGCTCCTGCTGCAGCGCCACTTGCTCGAACACCACCTCTTACCAGTTGTACTGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Prolamin_like

Protein Analysis

102

Amino Acids

10.76

Weight (kDa)

5.72

Isoelectric Point (pI)

41.43

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Prolamin_like PF05617 12 - 76 4.9e-17 Prolamin-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 210
AciI CCGC 2 cut(s) 39, 233
AcsI RAATTY 1 cut(s) 20
AcyI GRCGYC 1 cut(s) 207
AfaI GTAC 1 cut(s) 301
AluBI AGCT 2 cut(s) 58, 134
AluI AGCT 2 cut(s) 58, 134
AoxI GGCC 1 cut(s) 161
ApeKI GCWGC 4 cut(s) 230, 236, 260, 263
ApoI RAATTY 1 cut(s) 20
AspLEI GCGC 1 cut(s) 268
AspS9I GGNCC 1 cut(s) 116
AsuHPI GGTGA 1 cut(s) 215
AvaII GGWCC 1 cut(s) 116
BbvI GCAGC 4 cut(s) 217, 223, 247, 275
BcgI CGANNNNNNTGC 2 cut(s) 118, 152
BfaI CTAG 2 cut(s) 14, 29
BfmI CTRYAG 2 cut(s) 192, 261
BfoI RGCGCY 1 cut(s) 269
BisI GCNGC 5 cut(s) 231, 234, 237, 261, 264
BlsI GCNGC 5 cut(s) 232, 235, 238, 262, 265
Bme18I GGWCC 1 cut(s) 116
BmgT120I GGNCC 1 cut(s) 116
BmsI GCATC 1 cut(s) 217
BsaHI GRCGYC 1 cut(s) 207
BsaJI CCNNGG 1 cut(s) 181
BsaXI ACNNNNNCTCC 2 cut(s) 238, 268
Bse1I ACTGG 2 cut(s) 54, 294
BseDI CCNNGG 1 cut(s) 181
BseNI ACTGG 2 cut(s) 54, 294
BseXI GCAGC 4 cut(s) 217, 223, 247, 275
BshFI GGCC 1 cut(s) 163
BsmI GAATGC 1 cut(s) 41
BsnI GGCC 1 cut(s) 163
BspACI CCGC 2 cut(s) 39, 233
BspANI GGCC 1 cut(s) 163
BspMAI CTGCAG 2 cut(s) 196, 265
BsrI ACTGG 2 cut(s) 54, 294
BssECI CCNNGG 1 cut(s) 181
BssNI GRCGYC 1 cut(s) 207
BssT1I CCWWGG 1 cut(s) 181
Bst4CI ACNGT 2 cut(s) 125, 224
BstACI GRCGYC 1 cut(s) 207
BstC8I GCNNGC 2 cut(s) 71, 161
BstH2I RGCGCY 1 cut(s) 269
BstHHI GCGC 1 cut(s) 268
BstMWI GCNNNNNNNGC 4 cut(s) 169, 236, 260, 272
BstSFI CTRYAG 2 cut(s) 192, 261
BstV1I GCAGC 4 cut(s) 217, 223, 247, 275
BsuRI GGCC 1 cut(s) 163
BtsI GCAGTG 2 cut(s) 154, 189
BtsIMutI CAGTG 3 cut(s) 47, 154, 189
Cac8I GCNNGC 2 cut(s) 71, 161
CfoI GCGC 1 cut(s) 268
Cfr13I GGNCC 1 cut(s) 116
Csp6I GTAC 1 cut(s) 300
CviJI RGCY 7 cut(s) 58, 107, 134, 163, 186, 219, 236
CviKI_1 RGCY 7 cut(s) 58, 107, 134, 163, 186, 219, 236
CviQI GTAC 1 cut(s) 300
Eco130I CCWWGG 1 cut(s) 181
Eco47I GGWCC 1 cut(s) 116
EcoT14I CCWWGG 1 cut(s) 181
ErhI CCWWGG 1 cut(s) 181
Fnu4HI GCNGC 5 cut(s) 231, 234, 237, 261, 264
Fsp4HI GCNGC 5 cut(s) 231, 234, 237, 261, 264
FspBI CTAG 2 cut(s) 14, 29
GlaI GCGC 1 cut(s) 267
GluI GCNGC 5 cut(s) 231, 234, 237, 261, 264
HaeII RGCGCY 1 cut(s) 269
HaeIII GGCC 1 cut(s) 163
HhaI GCGC 1 cut(s) 268
Hin1I GRCGYC 1 cut(s) 207
Hin6I GCGC 1 cut(s) 266
HinP1I GCGC 1 cut(s) 266
HphI GGTGA 1 cut(s) 215
Hpy188III TCNNGA 2 cut(s) 94, 119
HpyAV CCTTC 1 cut(s) 97
HpyCH4III ACNGT 2 cut(s) 125, 224
HpyCH4IV ACGT 1 cut(s) 207
HpyCH4V TGCA 5 cut(s) 4, 47, 129, 194, 263
HpyF10VI GCNNNNNNNGC 4 cut(s) 169, 236, 260, 272
HpySE526I ACGT 1 cut(s) 207
Hsp92I GRCGYC 1 cut(s) 207
HspAI GCGC 1 cut(s) 266
LmnI GCTCC 2 cut(s) 55, 259
LpnPI CCDG 6 cut(s) 35, 107, 132, 145, 177, 270
Lsp1109I GCAGC 4 cut(s) 217, 223, 247, 275
LweI GCATC 1 cut(s) 217
MaeI CTAG 2 cut(s) 14, 29
MaeII ACGT 1 cut(s) 207
MaeIII GTNAC 2 cut(s) 203, 241
MluCI AATT 1 cut(s) 20
MnlI CCTC 2 cut(s) 209, 297
Mva1269I GAATGC 1 cut(s) 41
MwoI GCNNNNNNNGC 4 cut(s) 169, 236, 260, 272
NmuCI GTSAC 2 cut(s) 203, 241
PctI GAATGC 1 cut(s) 41
PkrI GCNGC 5 cut(s) 232, 235, 238, 262, 265
PspPI GGNCC 1 cut(s) 116
PstI CTGCAG 2 cut(s) 196, 265
RsaI GTAC 1 cut(s) 301
RsaNI GTAC 1 cut(s) 300
SatI GCNGC 5 cut(s) 231, 234, 237, 261, 264
Sau96I GGNCC 1 cut(s) 116
SetI ASST 5 cut(s) 60, 136, 205, 210, 289
SfaNI GCATC 1 cut(s) 217
SfcI CTRYAG 2 cut(s) 192, 261
SinI GGWCC 1 cut(s) 116
Sse9I AATT 1 cut(s) 20
SsiI CCGC 2 cut(s) 39, 233
SspMI CTAG 2 cut(s) 14, 29
StyI CCWWGG 1 cut(s) 181
TaaI ACNGT 2 cut(s) 125, 224
TaiI ACGT 1 cut(s) 210
TaqI TCGA 1 cut(s) 277
TaqII GACCGA 1 cut(s) 104
TasI AATT 1 cut(s) 20
TatI WGTACW 1 cut(s) 299
TauI GCSGC 1 cut(s) 236
TscAI CASTG 3 cut(s) 54, 161, 196
TseFI GTSAC 2 cut(s) 203, 241
TseI GCWGC 4 cut(s) 230, 236, 260, 263
Tsp45I GTSAC 2 cut(s) 203, 241
TspRI CASTG 3 cut(s) 54, 161, 196
VpaK11BI GGWCC 1 cut(s) 116
XapI RAATTY 1 cut(s) 20
XspI CTAG 2 cut(s) 14, 29
ZraI GACGTC 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.