Rroxscaffold_2G00124100

Egg cell-secreted protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
58220128 .. 58220499
372 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00124100.1

Sequence Viewer

Length: 372 bp
ATGGTGACACTGATCGCATCCCTCATACTGAGTGCAAGTAATGCAACTGCTACTAGGAAAATTTCTGACAAAACAAGCGGTGAAGGCGAAGGCGGGCTAGTGGAATGCGGAAATGCACTGGTGGAGCTGAAATCTTGCTCGCAAGAGATTGTTGTGTATTTCCTGAATGGGAAGGCTAATATCGGTCCAGACTGTTGCAAAGCTATCGCCACCATTACACGTCACTGCTGGCCTGCAATGCTTACTTCCCTTGGCTTCACTGCAGAACAAGGTGACGTCTTACGAGGCTACTGTGATGCTGCGGCGGCTGTGACTACTACTGCTCCTGCTGCAGCGCCACTTGCTCGTACAACACCTCTTACCAGTTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

123

Amino Acids

12.61

Weight (kDa)

5.71

Isoelectric Point (pI)

33.51

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Prolamin_like PF05617 35 - 99 1.9e-18 Prolamin-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 279
AciI CCGC 5 cut(s) 78, 93, 108, 302, 305
AcsI RAATTY 1 cut(s) 60
AcyI GRCGYC 1 cut(s) 276
AfaI GTAC 1 cut(s) 349
AflIII ACRYGT 1 cut(s) 218
AjiI CACGTC 1 cut(s) 221
AluBI AGCT 2 cut(s) 127, 203
AluI AGCT 2 cut(s) 127, 203
AoxI GGCC 1 cut(s) 230
ApeKI GCWGC 3 cut(s) 299, 329, 332
ApoI RAATTY 1 cut(s) 60
AspLEI GCGC 1 cut(s) 337
AspS9I GGNCC 1 cut(s) 185
AsuHPI GGTGA 3 cut(s) 16, 92, 284
AvaII GGWCC 1 cut(s) 185
BbvI GCAGC 3 cut(s) 286, 316, 344
BcgI CGANNNNNNTGC 2 cut(s) 187, 221
BfaI CTAG 2 cut(s) 54, 98
BfmI CTRYAG 2 cut(s) 261, 330
BfoI RGCGCY 1 cut(s) 338
BisI GCNGC 5 cut(s) 300, 303, 306, 330, 333
BlsI GCNGC 5 cut(s) 301, 304, 307, 331, 334
Bme18I GGWCC 1 cut(s) 185
BmgBI CACGTC 1 cut(s) 221
BmgT120I GGNCC 1 cut(s) 185
BmsI GCATC 2 cut(s) 26, 286
BsaHI GRCGYC 1 cut(s) 276
BsaJI CCNNGG 1 cut(s) 250
BsaXI ACNNNNNCTCC 2 cut(s) 307, 337
Bse1I ACTGG 2 cut(s) 123, 363
Bse3DI GCAATG 1 cut(s) 243
BseDI CCNNGG 1 cut(s) 250
BseGI GGATG 1 cut(s) 17
BseMI GCAATG 1 cut(s) 243
BseMII CTCAG 1 cut(s) 20
BseNI ACTGG 2 cut(s) 123, 363
BseXI GCAGC 3 cut(s) 286, 316, 344
BshFI GGCC 1 cut(s) 232
BsmI GAATGC 1 cut(s) 110
BsnI GGCC 1 cut(s) 232
Bsp143I GATC 1 cut(s) 12
BspACI CCGC 5 cut(s) 78, 93, 108, 302, 305
BspANI GGCC 1 cut(s) 232
BspCNI CTCAG 1 cut(s) 21
BspMAI CTGCAG 2 cut(s) 265, 334
BsrDI GCAATG 1 cut(s) 243
BsrI ACTGG 2 cut(s) 123, 363
BssECI CCNNGG 1 cut(s) 250
BssMI GATC 1 cut(s) 12
BssNI GRCGYC 1 cut(s) 276
BssT1I CCWWGG 1 cut(s) 250
Bst4CI ACNGT 2 cut(s) 194, 293
BstACI GRCGYC 1 cut(s) 276
BstAPI GCANNNNNTGC 1 cut(s) 41
BstC8I GCNNGC 4 cut(s) 95, 140, 230, 234
BstDEI CTNAG 1 cut(s) 29
BstF5I GGATG 1 cut(s) 17
BstH2I RGCGCY 1 cut(s) 338
BstHHI GCGC 1 cut(s) 337
BstKTI GATC 1 cut(s) 15
BstMBI GATC 1 cut(s) 12
BstMWI GCNNNNNNNGC 6 cut(s) 41, 84, 238, 305, 329, 341
BstSFI CTRYAG 2 cut(s) 261, 330
BstV1I GCAGC 3 cut(s) 286, 316, 344
BsuRI GGCC 1 cut(s) 232
BtrI CACGTC 1 cut(s) 221
BtsCI GGATG 1 cut(s) 17
BtsI GCAGTG 2 cut(s) 223, 258
BtsIMutI CAGTG 4 cut(s) 8, 116, 223, 258
Cac8I GCNNGC 4 cut(s) 95, 140, 230, 234
CfoI GCGC 1 cut(s) 337
Cfr13I GGNCC 1 cut(s) 185
Csp6I GTAC 1 cut(s) 348
CviJI RGCY 8 cut(s) 97, 127, 176, 203, 232, 255, 288, 308
CviKI_1 RGCY 8 cut(s) 97, 127, 176, 203, 232, 255, 288, 308
CviQI GTAC 1 cut(s) 348
DdeI CTNAG 1 cut(s) 29
DpnI GATC 1 cut(s) 14
DpnII GATC 1 cut(s) 12
Eco130I CCWWGG 1 cut(s) 250
Eco47I GGWCC 1 cut(s) 185
EcoT14I CCWWGG 1 cut(s) 250
ErhI CCWWGG 1 cut(s) 250
FaiI YATR 1 cut(s) 26
FauI CCCGC 1 cut(s) 86
Fnu4HI GCNGC 5 cut(s) 300, 303, 306, 330, 333
FokI GGATG 1 cut(s) 4
Fsp4HI GCNGC 5 cut(s) 300, 303, 306, 330, 333
FspBI CTAG 2 cut(s) 54, 98
GlaI GCGC 1 cut(s) 336
GluI GCNGC 5 cut(s) 300, 303, 306, 330, 333
HaeII RGCGCY 1 cut(s) 338
HaeIII GGCC 1 cut(s) 232
HhaI GCGC 1 cut(s) 337
Hin1I GRCGYC 1 cut(s) 276
Hin6I GCGC 1 cut(s) 335
HinP1I GCGC 1 cut(s) 335
HphI GGTGA 3 cut(s) 16, 92, 284
Hpy188I TCNGA 1 cut(s) 67
Hpy188III TCNNGA 2 cut(s) 163, 188
HpyAV CCTTC 3 cut(s) 77, 83, 166
HpyCH4III ACNGT 2 cut(s) 194, 293
HpyCH4IV ACGT 2 cut(s) 220, 276
HpyCH4V TGCA 7 cut(s) 35, 44, 116, 198, 236, 263, 332
HpyF10VI GCNNNNNNNGC 6 cut(s) 41, 84, 238, 305, 329, 341
HpyF3I CTNAG 1 cut(s) 29
HpySE526I ACGT 2 cut(s) 220, 276
Hsp92I GRCGYC 1 cut(s) 276
HspAI GCGC 1 cut(s) 335
Kzo9I GATC 1 cut(s) 12
LmnI GCTCC 2 cut(s) 124, 328
LpnPI CCDG 6 cut(s) 104, 176, 201, 214, 246, 339
Lsp1109I GCAGC 3 cut(s) 286, 316, 344
LweI GCATC 2 cut(s) 26, 286
MaeI CTAG 2 cut(s) 54, 98
MaeII ACGT 2 cut(s) 220, 276
MaeIII GTNAC 4 cut(s) 4, 221, 272, 310
MalI GATC 1 cut(s) 14
MboI GATC 1 cut(s) 12
MluCI AATT 1 cut(s) 60
MnlI CCTC 3 cut(s) 32, 278, 366
Mva1269I GAATGC 1 cut(s) 110
MwoI GCNNNNNNNGC 6 cut(s) 41, 84, 238, 305, 329, 341
NdeII GATC 1 cut(s) 12
NmuCI GTSAC 4 cut(s) 4, 221, 272, 310
PctI GAATGC 1 cut(s) 110
PkrI GCNGC 5 cut(s) 301, 304, 307, 331, 334
PspPI GGNCC 1 cut(s) 185
PstI CTGCAG 2 cut(s) 265, 334
RsaI GTAC 1 cut(s) 349
RsaNI GTAC 1 cut(s) 348
SatI GCNGC 5 cut(s) 300, 303, 306, 330, 333
Sau3AI GATC 1 cut(s) 12
Sau96I GGNCC 1 cut(s) 185
SetI ASST 6 cut(s) 129, 205, 223, 274, 279, 358
SfaNI GCATC 2 cut(s) 26, 286
SfcI CTRYAG 2 cut(s) 261, 330
SinI GGWCC 1 cut(s) 185
Sse9I AATT 1 cut(s) 60
SsiI CCGC 5 cut(s) 78, 93, 108, 302, 305
SspMI CTAG 2 cut(s) 54, 98
StyI CCWWGG 1 cut(s) 250
TaaI ACNGT 2 cut(s) 194, 293
TaiI ACGT 2 cut(s) 223, 279
TaqII GACCGA 1 cut(s) 173
TasI AATT 1 cut(s) 60
TauI GCSGC 2 cut(s) 305, 308
TscAI CASTG 4 cut(s) 15, 123, 230, 265
TseFI GTSAC 4 cut(s) 4, 221, 272, 310
TseI GCWGC 3 cut(s) 299, 329, 332
Tsp45I GTSAC 4 cut(s) 4, 221, 272, 310
TspRI CASTG 4 cut(s) 15, 123, 230, 265
VpaK11BI GGWCC 1 cut(s) 185
XapI RAATTY 1 cut(s) 60
XspI CTAG 2 cut(s) 54, 98
ZraI GACGTC 1 cut(s) 277
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.