Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001501.1

Orthogroup ID

OG0008373

Physical Location & Seq

Genomic Coordinates Forward (+)

346450 .. 346857

Gene Structure 408 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001501.1_g000085.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 408 bp

atggctttgaagaatttggttttggtttccatggtgacactgatcgcatccctcatactgagtgcaagtaatgcaactgctactaggaaaatttctgcagggatcaaaacgagcggtgaaggcgaaggcgggctagtggaatgcggaaatgcgctggtggagctgaaatcttgctcgcaagagattgttgtgtatttcctgaatgggaaggctaatatcggcccagactgttgcaaagctatcgccaccattacacgtcactgctggcctgcaatgcttacttcccttggcttcactgcacaacaaggtgacatcttacgaggctactgtgatgctgcggctgccgtgactactactgctcctgctgcggcgccacttgctcgtacaacacctcttaccagttgttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Prolamin_like

Protein Analysis

135

Amino Acids

13.82

Weight (kDa)

8.19

Isoelectric Point (pI)

32.5

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008373)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G21740 AT2G21750 AT4G39340
fragaria_vesca	FvH4_1g23830 FvH4_4g25660
malus_domestica	MD01G1001000.v1.1 MD15G1340900.v1.1
prunus_persica	Prupe.6G161600_v2.0.a1
pyrus_communis	pycom15g30040
rosa_chinensis	RchiOBHm_Chr2g0119721 RchiOBHm_Chr2g0119751
rosa_laevigata	RLG00000018487 RLG00000018490
rosa_multiflora	Rmu_sc0001501.1_g000060 Rmu_sc0001501.1_g000085
rosa_roxburghii	Rroxscaffold_2G00124100 Rroxscaffold_2G00124190
rosa_rugosa	Rorug02G0223000 Rorug02G0223400
rosa_samantha	Rh2BG292600 Rh2DG287500
rosa_wichuraiana	Rw2G022440 Rw2G022470

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	370
AccBSI	CCGCTC	1 cut(s)	114
AciI	CCGC	5 cut(s)	114, 129, 144, 338, 368
AclWI	GGATC	1 cut(s)	110
AcsI	RAATTY	2 cut(s)	13, 90
AcyI	GRCGYC	1 cut(s)	371
AfaI	GTAC	1 cut(s)	385
AflIII	ACRYGT	1 cut(s)	254
AgsI	TTSAA	1 cut(s)	10
AjiI	CACGTC	1 cut(s)	257
AjuI	GAANNNNNNNTTGG	1 cut(s)	37
AluBI	AGCT	2 cut(s)	163, 239
AluI	AGCT	2 cut(s)	163, 239
AlwI	GGATC	1 cut(s)	110
AoxI	GGCC	2 cut(s)	220, 266
ApeKI	GCWGC	3 cut(s)	335, 341, 365
ApoI	RAATTY	2 cut(s)	13, 90
AspLEI	GCGC	2 cut(s)	154, 373
AspS9I	GGNCC	1 cut(s)	221
AsuHPI	GGTGA	3 cut(s)	46, 128, 320
BanI	GGYRCC	1 cut(s)	370
BbvI	GCAGC	3 cut(s)	322, 328, 352
BceAI	ACGGC	1 cut(s)	329
BcgI	CGANNNNNNTGC	2 cut(s)	223, 257
BfaI	CTAG	2 cut(s)	84, 134
BfmI	CTRYAG	1 cut(s)	96
BfoI	RGCGCY	1 cut(s)	374
BisI	GCNGC	5 cut(s)	336, 339, 342, 366, 369
BlsI	GCNGC	5 cut(s)	337, 340, 343, 367, 370
BmgBI	CACGTC	1 cut(s)	257
BmgT120I	GGNCC	1 cut(s)	221
BmiI	GGNNCC	1 cut(s)	372
BmsI	GCATC	2 cut(s)	56, 322
BsaHI	GRCGYC	1 cut(s)	371
BsaJI	CCNNGG	2 cut(s)	30, 286
BsaXI	ACNNNNNCTCC	2 cut(s)	343, 373
Bse1I	ACTGG	1 cut(s)	399
Bse3DI	GCAATG	1 cut(s)	279
BseDI	CCNNGG	2 cut(s)	30, 286
BseGI	GGATG	1 cut(s)	47
BseMI	GCAATG	1 cut(s)	279
BseMII	CTCAG	1 cut(s)	50
BseNI	ACTGG	1 cut(s)	399
BseXI	GCAGC	3 cut(s)	322, 328, 352
BsgI	GTGCAG	1 cut(s)	282
BshFI	GGCC	2 cut(s)	222, 268
BshNI	GGYRCC	1 cut(s)	370
BsmI	GAATGC	1 cut(s)	146
BsnI	GGCC	2 cut(s)	222, 268
Bsp143I	GATC	2 cut(s)	42, 102
Bsp19I	CCATGG	1 cut(s)	30
BspACI	CCGC	5 cut(s)	114, 129, 144, 338, 368
BspANI	GGCC	2 cut(s)	222, 268
BspCNI	CTCAG	1 cut(s)	51
BspLI	GGNNCC	1 cut(s)	372
BspMAI	CTGCAG	1 cut(s)	100
BspPI	GGATC	1 cut(s)	110
BspT107I	GGYRCC	1 cut(s)	370
BsrBI	CCGCTC	1 cut(s)	114
BsrDI	GCAATG	1 cut(s)	279
BsrI	ACTGG	1 cut(s)	399
BssECI	CCNNGG	2 cut(s)	30, 286
BssMI	GATC	2 cut(s)	42, 102
BssNI	GRCGYC	1 cut(s)	371
BssT1I	CCWWGG	2 cut(s)	30, 286
Bst4CI	ACNGT	2 cut(s)	230, 329
BstACI	GRCGYC	1 cut(s)	371
BstAPI	GCANNNNNTGC	1 cut(s)	71
BstC8I	GCNNGC	4 cut(s)	131, 176, 266, 270
BstDEI	CTNAG	1 cut(s)	59
BstDSI	CCRYGG	1 cut(s)	30
BstF5I	GGATG	1 cut(s)	47
BstH2I	RGCGCY	1 cut(s)	374
BstHHI	GCGC	2 cut(s)	154, 373
BstKTI	GATC	2 cut(s)	45, 105
BstMBI	GATC	2 cut(s)	42, 102
BstMWI	GCNNNNNNNGC	7 cut(s)	71, 120, 160, 274, 341, 365, 377
BstSFI	CTRYAG	1 cut(s)	96
BstV1I	GCAGC	3 cut(s)	322, 328, 352
BsuRI	GGCC	2 cut(s)	222, 268
BtgI	CCRYGG	1 cut(s)	30
BtrI	CACGTC	1 cut(s)	257
BtsCI	GGATG	1 cut(s)	47
BtsI	GCAGTG	2 cut(s)	259, 294
BtsIMutI	CAGTG	3 cut(s)	38, 259, 294
Cac8I	GCNNGC	4 cut(s)	131, 176, 266, 270
CfoI	GCGC	2 cut(s)	154, 373
Cfr13I	GGNCC	1 cut(s)	221
Csp6I	GTAC	1 cut(s)	384
CviAII	CATG	1 cut(s)	31
CviQI	GTAC	1 cut(s)	384
DdeI	CTNAG	1 cut(s)	59
DinI	GGCGCC	1 cut(s)	372
DpnI	GATC	2 cut(s)	44, 104
DpnII	GATC	2 cut(s)	42, 102
Eco130I	CCWWGG	2 cut(s)	30, 286
EcoT14I	CCWWGG	2 cut(s)	30, 286
EgeI	GGCGCC	1 cut(s)	372
EheI	GGCGCC	1 cut(s)	372
ErhI	CCWWGG	2 cut(s)	30, 286
FaeI	CATG	1 cut(s)	34
FaiI	YATR	2 cut(s)	32, 56
FatI	CATG	1 cut(s)	30
FauI	CCCGC	1 cut(s)	122
Fnu4HI	GCNGC	5 cut(s)	336, 339, 342, 366, 369
FokI	GGATG	1 cut(s)	34
Fsp4HI	GCNGC	5 cut(s)	336, 339, 342, 366, 369
FspBI	CTAG	2 cut(s)	84, 134
GlaI	GCGC	2 cut(s)	153, 372
GluI	GCNGC	5 cut(s)	336, 339, 342, 366, 369
HaeII	RGCGCY	1 cut(s)	374
HaeIII	GGCC	2 cut(s)	222, 268
HhaI	GCGC	2 cut(s)	154, 373
Hin1I	GRCGYC	1 cut(s)	371
Hin1II	CATG	1 cut(s)	34
Hin6I	GCGC	2 cut(s)	152, 371
HinP1I	GCGC	2 cut(s)	152, 371
HphI	GGTGA	3 cut(s)	46, 128, 320
Hpy188III	TCNNGA	1 cut(s)	199
HpyAV	CCTTC	3 cut(s)	113, 119, 202
HpyCH4III	ACNGT	2 cut(s)	230, 329
HpyCH4IV	ACGT	1 cut(s)	256
HpyCH4V	TGCA	6 cut(s)	65, 74, 98, 234, 272, 299
HpyF10VI	GCNNNNNNNGC	7 cut(s)	71, 120, 160, 274, 341, 365, 377
HpyF3I	CTNAG	1 cut(s)	59
HpySE526I	ACGT	1 cut(s)	256
Hsp92I	GRCGYC	1 cut(s)	371
Hsp92II	CATG	1 cut(s)	34
HspAI	GCGC	2 cut(s)	152, 371
KasI	GGCGCC	1 cut(s)	370
Kzo9I	GATC	2 cut(s)	42, 102
LmnI	GCTCC	2 cut(s)	160, 364
LpnPI	CCDG	7 cut(s)	84, 140, 212, 237, 250, 282, 375
Lsp1109I	GCAGC	3 cut(s)	322, 328, 352
LweI	GCATC	2 cut(s)	56, 322
MaeI	CTAG	2 cut(s)	84, 134
MaeII	ACGT	1 cut(s)	256
MaeIII	GTNAC	4 cut(s)	34, 257, 308, 346
MalI	GATC	2 cut(s)	44, 104
MbiI	CCGCTC	1 cut(s)	114
MboI	GATC	2 cut(s)	42, 102
MboII	GAAGA	1 cut(s)	22
MluCI	AATT	2 cut(s)	13, 90
Mly113I	GGCGCC	1 cut(s)	371
MnlI	CCTC	3 cut(s)	62, 314, 402
Mva1269I	GAATGC	1 cut(s)	146
MwoI	GCNNNNNNNGC	7 cut(s)	71, 120, 160, 274, 341, 365, 377
NarI	GGCGCC	1 cut(s)	371
NcoI	CCATGG	1 cut(s)	30
NdeII	GATC	2 cut(s)	42, 102
NlaIII	CATG	1 cut(s)	34
NlaIV	GGNNCC	1 cut(s)	372
NmuCI	GTSAC	4 cut(s)	34, 257, 308, 346
PctI	GAATGC	1 cut(s)	146
PkrI	GCNGC	5 cut(s)	337, 340, 343, 367, 370
PluTI	GGCGCC	1 cut(s)	374
PspN4I	GGNNCC	1 cut(s)	372
PspPI	GGNCC	1 cut(s)	221
PstI	CTGCAG	1 cut(s)	100
RsaI	GTAC	1 cut(s)	385
RsaNI	GTAC	1 cut(s)	384
SatI	GCNGC	5 cut(s)	336, 339, 342, 366, 369
Sau3AI	GATC	2 cut(s)	42, 102
Sau96I	GGNCC	1 cut(s)	221
SetI	ASST	5 cut(s)	165, 241, 259, 310, 394
SfaNI	GCATC	2 cut(s)	56, 322
SfcI	CTRYAG	1 cut(s)	96
SfoI	GGCGCC	1 cut(s)	372
Sse9I	AATT	2 cut(s)	13, 90
SsiI	CCGC	5 cut(s)	114, 129, 144, 338, 368
SspDI	GGCGCC	1 cut(s)	370
SspMI	CTAG	2 cut(s)	84, 134
StyI	CCWWGG	2 cut(s)	30, 286
TaaI	ACNGT	2 cut(s)	230, 329
TaiI	ACGT	1 cut(s)	259
TasI	AATT	2 cut(s)	13, 90
TauI	GCSGC	2 cut(s)	341, 371
TscAI	CASTG	3 cut(s)	45, 266, 301
TseFI	GTSAC	4 cut(s)	34, 257, 308, 346
TseI	GCWGC	3 cut(s)	335, 341, 365
Tsp45I	GTSAC	4 cut(s)	34, 257, 308, 346
TspRI	CASTG	3 cut(s)	45, 266, 301
XapI	RAATTY	2 cut(s)	13, 90
XspI	CTAG	2 cut(s)	84, 134

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.