Rh2DG287500

Egg cell-secreted protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
33476287 .. 33476688
402 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG287500.1

Sequence Viewer

Length: 402 bp
ATGGCTGTGAAGAATTTGGTTTTGGTTTCCATGGTGACACTGATCGCATCCCTCATACTGAGTGCAAGTAATGCAACTGCTACTAGGAAAATTTCTGACAAAACGAGCAGTGAAGGCGAAGGCGGGCTAGTGGAATGCGGAAATGCACTGGTGGAGCTGAAATCTTGTTCGCAAGACATTGTTGTGTATTTCCTGAATGGGAAGGCTAATATCGGTCCAGACTGTTGCAAAGCTATCGCCACCATTACACGTCACTGCTGGCCTGCAATGCTTACTTCCCTTGGCTTCACTGCAGAACAAGGTGATGTCTTACGAGGCTACTGTGATGCTGCGGCTGATGTGACCACTACTGCCCCTGCTGCAGCGCCACTTGCTCGAACAACACCTCTTACCAGTTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

133

Amino Acids

13.72

Weight (kDa)

5.71

Isoelectric Point (pI)

33.83

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Prolamin_like PF05617 45 - 109 5.9e-18 Prolamin-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 123, 138, 332
AcsI RAATTY 2 cut(s) 13, 90
AflIII ACRYGT 1 cut(s) 248
AjiI CACGTC 1 cut(s) 251
AjuI GAANNNNNNNTTGG 1 cut(s) 37
AluBI AGCT 2 cut(s) 157, 233
AluI AGCT 2 cut(s) 157, 233
AoxI GGCC 1 cut(s) 260
ApeKI GCWGC 3 cut(s) 329, 359, 362
ApoI RAATTY 2 cut(s) 13, 90
AspLEI GCGC 1 cut(s) 367
AspS9I GGNCC 1 cut(s) 215
AsuHPI GGTGA 2 cut(s) 46, 314
AvaII GGWCC 1 cut(s) 215
BbvI GCAGC 3 cut(s) 316, 346, 374
BcgI CGANNNNNNTGC 2 cut(s) 217, 251
BfaI CTAG 2 cut(s) 84, 128
BfmI CTRYAG 2 cut(s) 291, 360
BfoI RGCGCY 1 cut(s) 368
BisI GCNGC 4 cut(s) 330, 333, 360, 363
BlsI GCNGC 4 cut(s) 331, 334, 361, 364
Bme18I GGWCC 1 cut(s) 215
BmgBI CACGTC 1 cut(s) 251
BmgT120I GGNCC 1 cut(s) 215
BmsI GCATC 2 cut(s) 56, 316
BsaJI CCNNGG 2 cut(s) 30, 280
Bse1I ACTGG 2 cut(s) 153, 393
Bse3DI GCAATG 1 cut(s) 273
BseDI CCNNGG 2 cut(s) 30, 280
BseGI GGATG 1 cut(s) 47
BseMI GCAATG 1 cut(s) 273
BseMII CTCAG 1 cut(s) 50
BseNI ACTGG 2 cut(s) 153, 393
BseXI GCAGC 3 cut(s) 316, 346, 374
BshFI GGCC 1 cut(s) 262
BsmI GAATGC 1 cut(s) 140
BsnI GGCC 1 cut(s) 262
Bsp143I GATC 1 cut(s) 42
Bsp19I CCATGG 1 cut(s) 30
BspACI CCGC 3 cut(s) 123, 138, 332
BspANI GGCC 1 cut(s) 262
BspCNI CTCAG 1 cut(s) 51
BspMAI CTGCAG 2 cut(s) 295, 364
BsrDI GCAATG 1 cut(s) 273
BsrI ACTGG 2 cut(s) 153, 393
BssECI CCNNGG 2 cut(s) 30, 280
BssMI GATC 1 cut(s) 42
BssT1I CCWWGG 2 cut(s) 30, 280
Bst4CI ACNGT 2 cut(s) 224, 323
BstAPI GCANNNNNTGC 1 cut(s) 71
BstC8I GCNNGC 3 cut(s) 125, 260, 264
BstDEI CTNAG 1 cut(s) 59
BstDSI CCRYGG 1 cut(s) 30
BstF5I GGATG 1 cut(s) 47
BstH2I RGCGCY 1 cut(s) 368
BstHHI GCGC 1 cut(s) 367
BstKTI GATC 1 cut(s) 45
BstMBI GATC 1 cut(s) 42
BstMWI GCNNNNNNNGC 5 cut(s) 71, 114, 268, 359, 371
BstSFI CTRYAG 2 cut(s) 291, 360
BstV1I GCAGC 3 cut(s) 316, 346, 374
BsuRI GGCC 1 cut(s) 262
BtgI CCRYGG 1 cut(s) 30
BtrI CACGTC 1 cut(s) 251
BtsCI GGATG 1 cut(s) 47
BtsI GCAGTG 3 cut(s) 115, 253, 288
BtsIMutI CAGTG 5 cut(s) 38, 115, 146, 253, 288
Cac8I GCNNGC 3 cut(s) 125, 260, 264
CfoI GCGC 1 cut(s) 367
Cfr13I GGNCC 1 cut(s) 215
CviAII CATG 1 cut(s) 31
CviJI RGCY 9 cut(s) 5, 127, 157, 206, 233, 262, 285, 318, 335
CviKI_1 RGCY 9 cut(s) 5, 127, 157, 206, 233, 262, 285, 318, 335
DdeI CTNAG 1 cut(s) 59
DpnI GATC 1 cut(s) 44
DpnII GATC 1 cut(s) 42
Eco130I CCWWGG 2 cut(s) 30, 280
Eco47I GGWCC 1 cut(s) 215
EcoT14I CCWWGG 2 cut(s) 30, 280
ErhI CCWWGG 2 cut(s) 30, 280
FaeI CATG 1 cut(s) 34
FaiI YATR 2 cut(s) 32, 56
FatI CATG 1 cut(s) 30
FauI CCCGC 1 cut(s) 116
Fnu4HI GCNGC 4 cut(s) 330, 333, 360, 363
FokI GGATG 1 cut(s) 34
Fsp4HI GCNGC 4 cut(s) 330, 333, 360, 363
FspBI CTAG 2 cut(s) 84, 128
GlaI GCGC 1 cut(s) 366
GluI GCNGC 4 cut(s) 330, 333, 360, 363
HaeII RGCGCY 1 cut(s) 368
HaeIII GGCC 1 cut(s) 262
HhaI GCGC 1 cut(s) 367
Hin1II CATG 1 cut(s) 34
Hin6I GCGC 1 cut(s) 365
HinP1I GCGC 1 cut(s) 365
HphI GGTGA 2 cut(s) 46, 314
Hpy188I TCNGA 1 cut(s) 97
Hpy188III TCNNGA 2 cut(s) 193, 218
HpyAV CCTTC 3 cut(s) 107, 113, 196
HpyCH4III ACNGT 2 cut(s) 224, 323
HpyCH4IV ACGT 1 cut(s) 250
HpyCH4V TGCA 7 cut(s) 65, 74, 146, 228, 266, 293, 362
HpyF10VI GCNNNNNNNGC 5 cut(s) 71, 114, 268, 359, 371
HpyF3I CTNAG 1 cut(s) 59
HpySE526I ACGT 1 cut(s) 250
Hsp92II CATG 1 cut(s) 34
HspAI GCGC 1 cut(s) 365
Kzo9I GATC 1 cut(s) 42
LmnI GCTCC 1 cut(s) 154
LpnPI CCDG 6 cut(s) 134, 206, 231, 244, 276, 369
Lsp1109I GCAGC 3 cut(s) 316, 346, 374
LweI GCATC 2 cut(s) 56, 316
MaeI CTAG 2 cut(s) 84, 128
MaeII ACGT 1 cut(s) 250
MaeIII GTNAC 3 cut(s) 34, 251, 340
MalI GATC 1 cut(s) 44
MboI GATC 1 cut(s) 42
MboII GAAGA 1 cut(s) 22
MluCI AATT 2 cut(s) 13, 90
MnlI CCTC 3 cut(s) 62, 308, 396
MslI CAYNNNNRTG 1 cut(s) 182
Mva1269I GAATGC 1 cut(s) 140
MwoI GCNNNNNNNGC 5 cut(s) 71, 114, 268, 359, 371
NcoI CCATGG 1 cut(s) 30
NdeII GATC 1 cut(s) 42
NlaIII CATG 1 cut(s) 34
NmuCI GTSAC 3 cut(s) 34, 251, 340
PctI GAATGC 1 cut(s) 140
PkrI GCNGC 4 cut(s) 331, 334, 361, 364
PspPI GGNCC 1 cut(s) 215
PstI CTGCAG 2 cut(s) 295, 364
RseI CAYNNNNRTG 1 cut(s) 182
SatI GCNGC 4 cut(s) 330, 333, 360, 363
Sau3AI GATC 1 cut(s) 42
Sau96I GGNCC 1 cut(s) 215
SetI ASST 5 cut(s) 159, 235, 253, 304, 388
SfaNI GCATC 2 cut(s) 56, 316
SfcI CTRYAG 2 cut(s) 291, 360
SinI GGWCC 1 cut(s) 215
SmiMI CAYNNNNRTG 1 cut(s) 182
Sse9I AATT 2 cut(s) 13, 90
SsiI CCGC 3 cut(s) 123, 138, 332
SspMI CTAG 2 cut(s) 84, 128
StyI CCWWGG 2 cut(s) 30, 280
TaaI ACNGT 2 cut(s) 224, 323
TaiI ACGT 1 cut(s) 253
TaqI TCGA 1 cut(s) 376
TaqII GACCGA 1 cut(s) 203
TasI AATT 2 cut(s) 13, 90
TauI GCSGC 1 cut(s) 335
TscAI CASTG 5 cut(s) 45, 115, 153, 260, 295
TseFI GTSAC 3 cut(s) 34, 251, 340
TseI GCWGC 3 cut(s) 329, 359, 362
Tsp45I GTSAC 3 cut(s) 34, 251, 340
TspRI CASTG 5 cut(s) 45, 115, 153, 260, 295
VpaK11BI GGWCC 1 cut(s) 215
XapI RAATTY 2 cut(s) 13, 90
XspI CTAG 2 cut(s) 84, 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.