RchiOBHm_Chr2g0131801

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
48175159 .. 48175497
339 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50311

Sequence Viewer

Length: 231 bp
ATGATATTACCATCCACATTACAAGTACATGCTATACACATATGCCATGCTTCTATTTTAATTGCAAAATTAAATAAGTATGGGAAACTCAAACAAAATTTTATTACTTGCTCTATGTGTTTATCATTTTTCAACCAACCGCCAAGCGGTAAGGCTACGCCTCATAATGACAATGACCGCTACGCGGCATTGCAGTCAAGTTTCTCATTTGAGAAAACAGTAAGGGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.54

Weight (kDa)

9.22

Isoelectric Point (pI)

58.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 185
AciI CCGC 4 cut(s) 140, 147, 178, 185
AcsI RAATTY 1 cut(s) 97
AfaI GTAC 1 cut(s) 27
AfiI CCNNNNNNNGG 2 cut(s) 146, 184
AgsI TTSAA 1 cut(s) 133
ApoI RAATTY 1 cut(s) 97
BccI CCATC 1 cut(s) 19
BfaI CTAG 1 cut(s) 229
BisI GCNGC 1 cut(s) 186
BlsI GCNGC 1 cut(s) 187
Bsc4I CCNNNNNNNGG 2 cut(s) 146, 184
Bse3DI GCAATG 1 cut(s) 188
BseGI GGATG 1 cut(s) 11
BseLI CCNNNNNNNGG 2 cut(s) 146, 184
BseMI GCAATG 1 cut(s) 188
Bsh1236I CGCG 1 cut(s) 185
BslI CCNNNNNNNGG 2 cut(s) 146, 184
BspACI CCGC 4 cut(s) 140, 147, 178, 185
BspFNI CGCG 1 cut(s) 185
BsrDI GCAATG 1 cut(s) 188
Bst4CI ACNGT 1 cut(s) 220
BstF5I GGATG 1 cut(s) 11
BstFNI CGCG 1 cut(s) 185
BstNSI RCATGY 1 cut(s) 32
BstUI CGCG 1 cut(s) 185
BtsCI GGATG 1 cut(s) 11
Csp6I GTAC 1 cut(s) 26
CviAII CATG 2 cut(s) 29, 47
CviJI RGCY 1 cut(s) 155
CviKI_1 RGCY 1 cut(s) 155
CviQI GTAC 1 cut(s) 26
FaeI CATG 2 cut(s) 32, 50
FaiI YATR 8 cut(s) 30, 35, 41, 43, 48, 81, 116, 165
FatI CATG 2 cut(s) 28, 46
FauNDI CATATG 1 cut(s) 41
Fnu4HI GCNGC 1 cut(s) 186
Fsp4HI GCNGC 1 cut(s) 186
FspBI CTAG 1 cut(s) 229
GluI GCNGC 1 cut(s) 186
Hin1II CATG 2 cut(s) 32, 50
HpyCH4III ACNGT 1 cut(s) 220
HpyCH4V TGCA 2 cut(s) 65, 193
Hsp92II CATG 2 cut(s) 32, 50
MaeI CTAG 1 cut(s) 229
MluCI AATT 3 cut(s) 60, 68, 97
MnlI CCTC 1 cut(s) 171
MseI TTAA 2 cut(s) 59, 71
MvnI CGCG 1 cut(s) 185
NdeI CATATG 1 cut(s) 41
NlaIII CATG 2 cut(s) 32, 50
NspI RCATGY 1 cut(s) 32
PkrI GCNGC 1 cut(s) 187
RsaI GTAC 1 cut(s) 27
RsaNI GTAC 1 cut(s) 26
SaqAI TTAA 2 cut(s) 59, 71
SatI GCNGC 1 cut(s) 186
SgeI CNNG 7 cut(s) 35, 41, 59, 120, 156, 196, 210
Sse9I AATT 3 cut(s) 60, 68, 97
SsiI CCGC 4 cut(s) 140, 147, 178, 185
SspMI CTAG 1 cut(s) 229
TaaI ACNGT 1 cut(s) 220
TasI AATT 3 cut(s) 60, 68, 97
TatI WGTACW 1 cut(s) 25
TauI GCSGC 1 cut(s) 188
Tru1I TTAA 2 cut(s) 59, 71
Tru9I TTAA 2 cut(s) 59, 71
XapI RAATTY 1 cut(s) 97
XceI RCATGY 1 cut(s) 32
XspI CTAG 1 cut(s) 229
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.