Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000005

Orthogroup ID

OG0012570

Physical Location & Seq

Genomic Coordinates Reverse (-)

64228556 .. 64230890

Gene Structure 2335 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_5G00385080.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 312 bp

ATGTCCAAGCTACGCTACGGTAGTCGGAAGCGGCCAATACCTCGCCCGGAAGGCTACGTAGCGGCAAATACCTCACCGGGAAGCCACCTTCCCGCCTTGCAAACCTCTTGGCCACCATATTTTGTCAAACCCGCCCCACGGGAAAGAGACCTAAATGGGTCTAAACTCCACGAGTCTAGGGTCCACAACCAACAGCCAAGCAAGAAGGCAATGCCTCATAATGACAATGACCGCTACGCGGCATTACGATCAAGCTTTTCTCCTCCGGAAAGAGTAAAGGGACCGGTTAACGCAGCCCACGGCAGCCATTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

103

Amino Acids

11.5

Weight (kDa)

10.57

Isoelectric Point (pI)

67.29

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012570)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g29683 FvH4_1g29684 FvH4_4g02083
pyrus_communis	pycom12g06170
rosa_chinensis	RchiOBHm_Chr2g0131801
rosa_multiflora	Rmu_sc0000319.1_g000006 Rmu_sc0001296.1_g000010 Rmu_sc0002563.1_g000042 Rmu_sc0004717.1_g000001 Rmu_sc0023614.1_g000002
rosa_roxburghii	Rroxscaffold_1G00045600 Rroxscaffold_2G00076110 Rroxscaffold_3G00230440 Rroxscaffold_5G00347270 Rroxscaffold_5G00366690 Rroxscaffold_5G00385080 Rroxscaffold_7G00167830 Rroxscaffold_7G00203970 Rroxscaffold_7G00207850

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	239
AccIII	TCCGGA	1 cut(s)	265
AciI	CCGC	6 cut(s)	31, 62, 93, 132, 232, 239
AcoI	YGGCCR	2 cut(s)	32, 110
AfiI	CCNNNNNNNGG	2 cut(s)	138, 238
AgeI	ACCGGT	1 cut(s)	283
AluBI	AGCT	2 cut(s)	10, 255
AluI	AGCT	2 cut(s)	10, 255
Alw26I	GTCTC	1 cut(s)	141
Aor13HI	TCCGGA	1 cut(s)	265
AoxI	GGCC	2 cut(s)	32, 110
ApeKI	GCWGC	2 cut(s)	293, 303
AsiGI	ACCGGT	1 cut(s)	283
AspS9I	GGNCC	2 cut(s)	181, 281
AsuC2I	CCSGG	2 cut(s)	47, 78
AsuHPI	GGTGA	1 cut(s)	66
AvaII	GGWCC	2 cut(s)	181, 281
BalI	TGGCCA	1 cut(s)	112
BauI	CACGAG	1 cut(s)	170
BbvI	GCAGC	1 cut(s)	305
BcnI	CCSGG	2 cut(s)	47, 78
BcoDI	GTCTC	1 cut(s)	141
BfaI	CTAG	1 cut(s)	177
BglI	GCCNNNNNGGC	1 cut(s)	51
BisI	GCNGC	5 cut(s)	32, 63, 240, 294, 304
BlsI	GCNGC	5 cut(s)	33, 64, 241, 295, 305
Bme1390I	CCNGG	2 cut(s)	47, 78
Bme18I	GGWCC	2 cut(s)	181, 281
BmgT120I	GGNCC	2 cut(s)	181, 281
BmiI	GGNNCC	2 cut(s)	182, 282
BmrFI	CCNGG	2 cut(s)	47, 78
BpuMI	CCSGG	2 cut(s)	47, 78
BsaAI	YACGTR	1 cut(s)	58
BsaI	GGTCTC	1 cut(s)	141
BsaJI	CCNNGG	2 cut(s)	137, 298
BsaWI	WCCGGW	2 cut(s)	265, 283
Bsc4I	CCNNNNNNNGG	2 cut(s)	138, 238
Bse118I	RCCGGY	1 cut(s)	283
Bse3DI	GCAATG	1 cut(s)	216
BseAI	TCCGGA	1 cut(s)	265
BseDI	CCNNGG	2 cut(s)	137, 298
BseLI	CCNNNNNNNGG	2 cut(s)	138, 238
BseMI	GCAATG	1 cut(s)	216
BseRI	GAGGAG	1 cut(s)	252
BseXI	GCAGC	1 cut(s)	305
Bsh1236I	CGCG	1 cut(s)	239
BshFI	GGCC	2 cut(s)	34, 112
BshTI	ACCGGT	1 cut(s)	283
BsiSI	CCGG	4 cut(s)	47, 77, 266, 284
BslFI	GGGAC	1 cut(s)	294
BslI	CCNNNNNNNGG	2 cut(s)	138, 238
BsmAI	GTCTC	1 cut(s)	141
BsmFI	GGGAC	1 cut(s)	294
BsnI	GGCC	2 cut(s)	34, 112
Bso31I	GGTCTC	1 cut(s)	141
Bsp13I	TCCGGA	1 cut(s)	265
Bsp143I	GATC	1 cut(s)	248
BspACI	CCGC	6 cut(s)	31, 62, 93, 132, 232, 239
BspANI	GGCC	2 cut(s)	34, 112
BspEI	TCCGGA	1 cut(s)	265
BspFNI	CGCG	1 cut(s)	239
BspLI	GGNNCC	2 cut(s)	182, 282
BspTNI	GGTCTC	1 cut(s)	141
BsrDI	GCAATG	1 cut(s)	216
BsrFI	RCCGGY	1 cut(s)	283
BssAI	RCCGGY	1 cut(s)	283
BssECI	CCNNGG	2 cut(s)	137, 298
BssMI	GATC	1 cut(s)	248
BssSI	CACGAG	1 cut(s)	170
Bst2BI	CACGAG	1 cut(s)	170
Bst4CI	ACNGT	1 cut(s)	20
BstBAI	YACGTR	1 cut(s)	58
BstDSI	CCRYGG	2 cut(s)	137, 298
BstFNI	CGCG	1 cut(s)	239
BstKTI	GATC	1 cut(s)	251
BstMAI	GTCTC	1 cut(s)	141
BstMBI	GATC	1 cut(s)	248
BstMWI	GCNNNNNNNGC	1 cut(s)	51
BstSCI	CCNGG	2 cut(s)	45, 76
BstSNI	TACGTA	1 cut(s)	58
BstUI	CGCG	1 cut(s)	239
BstV1I	GCAGC	1 cut(s)	305
BsuRI	GGCC	2 cut(s)	34, 112
BtgI	CCRYGG	2 cut(s)	137, 298
Cfr10I	RCCGGY	1 cut(s)	283
Cfr13I	GGNCC	2 cut(s)	181, 281
CspAI	ACCGGT	1 cut(s)	283
CviJI	RGCY	9 cut(s)	10, 34, 54, 84, 112, 196, 255, 296, 306
CviKI_1	RGCY	9 cut(s)	10, 34, 54, 84, 112, 196, 255, 296, 306
DpnI	GATC	1 cut(s)	250
DpnII	GATC	1 cut(s)	248
EaeI	YGGCCR	2 cut(s)	32, 110
Eco105I	TACGTA	1 cut(s)	58
Eco31I	GGTCTC	1 cut(s)	141
Eco47I	GGWCC	2 cut(s)	181, 281
FaiI	YATR	2 cut(s)	118, 219
FaqI	GGGAC	1 cut(s)	294
FauI	CCCGC	2 cut(s)	100, 139
Fnu4HI	GCNGC	5 cut(s)	32, 63, 240, 294, 304
Fsp4HI	GCNGC	5 cut(s)	32, 63, 240, 294, 304
FspBI	CTAG	1 cut(s)	177
GluI	GCNGC	5 cut(s)	32, 63, 240, 294, 304
HaeIII	GGCC	2 cut(s)	34, 112
HapII	CCGG	4 cut(s)	47, 77, 266, 284
HincII	GTYRAC	1 cut(s)	289
HindII	GTYRAC	1 cut(s)	289
HindIII	AAGCTT	1 cut(s)	253
HinfI	GANTC	1 cut(s)	173
HpaI	GTTAAC	1 cut(s)	289
HpaII	CCGG	4 cut(s)	47, 77, 266, 284
HphI	GGTGA	1 cut(s)	66
Hpy166II	GTNNAC	2 cut(s)	184, 289
Hpy188I	TCNGA	1 cut(s)	27
Hpy188III	TCNNGA	1 cut(s)	266
Hpy8I	GTNNAC	2 cut(s)	184, 289
HpyAV	CCTTC	3 cut(s)	44, 98, 199
HpyCH4III	ACNGT	1 cut(s)	20
HpyCH4IV	ACGT	1 cut(s)	57
HpyCH4V	TGCA	1 cut(s)	100
HpyF10VI	GCNNNNNNNGC	1 cut(s)	51
HpySE526I	ACGT	1 cut(s)	57
Kpn2I	TCCGGA	1 cut(s)	265
KspAI	GTTAAC	1 cut(s)	289
Kzo9I	GATC	1 cut(s)	248
LpnPI	CCDG	4 cut(s)	60, 90, 279, 297
Lsp1109I	GCAGC	1 cut(s)	305
MaeI	CTAG	1 cut(s)	177
MaeII	ACGT	1 cut(s)	57
MalI	GATC	1 cut(s)	250
MboI	GATC	1 cut(s)	248
MlsI	TGGCCA	1 cut(s)	112
MluNI	TGGCCA	1 cut(s)	112
MlyI	GAGTC	1 cut(s)	182
MmeI	TCCRAC	1 cut(s)	5
MnlI	CCTC	5 cut(s)	51, 82, 115, 225, 273
Mox20I	TGGCCA	1 cut(s)	112
MroI	TCCGGA	1 cut(s)	265
MscI	TGGCCA	1 cut(s)	112
MseI	TTAA	1 cut(s)	288
Msp20I	TGGCCA	1 cut(s)	112
MspI	CCGG	4 cut(s)	47, 77, 266, 284
MspR9I	CCNGG	2 cut(s)	47, 78
MvnI	CGCG	1 cut(s)	239
MwoI	GCNNNNNNNGC	1 cut(s)	51
NciI	CCSGG	2 cut(s)	47, 78
NdeII	GATC	1 cut(s)	248
NlaIV	GGNNCC	2 cut(s)	182, 282
PinAI	ACCGGT	1 cut(s)	283
PkrI	GCNGC	5 cut(s)	33, 64, 241, 295, 305
PleI	GAGTC	1 cut(s)	181
PpsI	GAGTC	1 cut(s)	181
Ppu21I	YACGTR	1 cut(s)	58
PspN4I	GGNNCC	2 cut(s)	182, 282
PspPI	GGNCC	2 cut(s)	181, 281
SaqAI	TTAA	1 cut(s)	288
SatI	GCNGC	5 cut(s)	32, 63, 240, 294, 304
Sau3AI	GATC	1 cut(s)	248
Sau96I	GGNCC	2 cut(s)	181, 281
SchI	GAGTC	1 cut(s)	182
ScrFI	CCNGG	2 cut(s)	47, 78
SetI	ASST	8 cut(s)	12, 43, 60, 74, 90, 107, 153, 257
SinI	GGWCC	2 cut(s)	181, 281
SnaBI	TACGTA	1 cut(s)	58
SsiI	CCGC	6 cut(s)	31, 62, 93, 132, 232, 239
SspMI	CTAG	1 cut(s)	177
StyD4I	CCNGG	2 cut(s)	45, 76
TaaI	ACNGT	1 cut(s)	20
TaiI	ACGT	1 cut(s)	60
TauI	GCSGC	3 cut(s)	34, 65, 242
Tru1I	TTAA	1 cut(s)	288
Tru9I	TTAA	1 cut(s)	288
TseI	GCWGC	2 cut(s)	293, 303
VpaK11BI	GGWCC	2 cut(s)	181, 281
XspI	CTAG	1 cut(s)	177

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.