Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0023614.1

Orthogroup ID

OG0012570

Physical Location & Seq

Genomic Coordinates Forward (+)

2740 .. 3225

Gene Structure 486 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0023614.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 486 bp

atgccaaggaatcctcccatgcaaaattatcaagggccggttgaacaaaagaaaccatcccttgaagagaccatgcagcaacttgcacaaaatcagatggaatttcaaaaggccaatgctcagatgcttcaagctattcaggagaccaagaaagagcagcaagttcaatctcaagctatttctaagctagaagttcaagttggtcagattgccactgctttgaatgagagagaacaagggcgtttacctagccaaactcttgctaatccaaggggtcaatttgagaaacaggagcctatgaaagctgtgatcacattgaggagtggaaaagaagttgatataaaagttcgtagtccaagagataaagaagaagtcaaacggggaaacccagaaattaatgaatcagcagagaaggaatcagcagagggattgaaactgcaacagcaatcccggggattgaagttgcaacagcaatcccgaaaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Asp_protease_2 Retrotrans_gag

Protein Analysis

161

Amino Acids

18.35

Weight (kDa)

9.48

Isoelectric Point (pI)

59.76

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012570)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g29683 FvH4_1g29684 FvH4_4g02083
pyrus_communis	pycom12g06170
rosa_chinensis	RchiOBHm_Chr2g0131801
rosa_multiflora	Rmu_sc0000319.1_g000006 Rmu_sc0001296.1_g000010 Rmu_sc0002563.1_g000042 Rmu_sc0004717.1_g000001 Rmu_sc0023614.1_g000002
rosa_roxburghii	Rroxscaffold_1G00045600 Rroxscaffold_2G00076110 Rroxscaffold_3G00230440 Rroxscaffold_5G00347270 Rroxscaffold_5G00366690 Rroxscaffold_5G00385080 Rroxscaffold_7G00167830 Rroxscaffold_7G00203970 Rroxscaffold_7G00207850

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	101
AgsI	TTSAA	9 cut(s)	44, 65, 107, 131, 167, 197, 223, 433, 460
AjuI	GAANNNNNNNTTGG	2 cut(s)	183, 215
AluBI	AGCT	4 cut(s)	134, 176, 187, 305
AluI	AGCT	4 cut(s)	134, 176, 187, 305
Alw26I	GTCTC	2 cut(s)	62, 137
Ama87I	CYCGRG	1 cut(s)	450
AoxI	GGCC	2 cut(s)	35, 111
ApeKI	GCWGC	2 cut(s)	76, 157
ApoI	RAATTY	1 cut(s)	101
AseI	ATTAAT	1 cut(s)	396
AspS9I	GGNCC	1 cut(s)	35
AsuC2I	CCSGG	2 cut(s)	451, 452
AvaI	CYCGRG	1 cut(s)	450
BbvI	GCAGC	2 cut(s)	88, 169
BccI	CCATC	2 cut(s)	64, 91
BclI	TGATCA	1 cut(s)	309
BcnI	CCSGG	2 cut(s)	451, 452
BcoDI	GTCTC	2 cut(s)	62, 137
BfaI	CTAG	2 cut(s)	188, 249
BisI	GCNGC	2 cut(s)	77, 158
BlsI	GCNGC	2 cut(s)	78, 159
Bme1390I	CCNGG	2 cut(s)	451, 452
BmeT110I	CYCGRG	1 cut(s)	450
BmgT120I	GGNCC	1 cut(s)	35
BmiI	GGNNCC	1 cut(s)	294
BmrFI	CCNGG	2 cut(s)	451, 452
BmsI	GCATC	1 cut(s)	114
BpuEI	CTTGAG	1 cut(s)	156
BpuMI	CCSGG	2 cut(s)	451, 452
BsaI	GGTCTC	2 cut(s)	62, 137
BsaJI	CCNNGG	4 cut(s)	5, 269, 450, 451
Bse118I	RCCGGY	1 cut(s)	37
BseDI	CCNNGG	4 cut(s)	5, 269, 450, 451
BseGI	GGATG	1 cut(s)	56
BseMII	CTCAG	1 cut(s)	134
BseRI	GAGGAG	1 cut(s)	334
BseXI	GCAGC	2 cut(s)	88, 169
BshFI	GGCC	2 cut(s)	37, 113
BsiHKCI	CYCGRG	1 cut(s)	450
BsiSI	CCGG	2 cut(s)	38, 451
BsmAI	GTCTC	2 cut(s)	62, 137
BsnI	GGCC	2 cut(s)	37, 113
Bso31I	GGTCTC	2 cut(s)	62, 137
BsoBI	CYCGRG	1 cut(s)	450
Bsp143I	GATC	1 cut(s)	309
BspANI	GGCC	2 cut(s)	37, 113
BspCNI	CTCAG	1 cut(s)	133
BspLI	GGNNCC	1 cut(s)	294
BspTNI	GGTCTC	2 cut(s)	62, 137
BsrFI	RCCGGY	1 cut(s)	37
BssAI	RCCGGY	1 cut(s)	37
BssECI	CCNNGG	4 cut(s)	5, 269, 450, 451
BssMI	GATC	1 cut(s)	309
BssT1I	CCWWGG	2 cut(s)	5, 269
Bst6I	CTCTTC	1 cut(s)	60
BstDEI	CTNAG	2 cut(s)	120, 183
BstF5I	GGATG	1 cut(s)	56
BstKTI	GATC	1 cut(s)	312
BstMAI	GTCTC	2 cut(s)	62, 137
BstMBI	GATC	1 cut(s)	309
BstSCI	CCNGG	2 cut(s)	449, 450
BstV1I	GCAGC	2 cut(s)	88, 169
BsuRI	GGCC	2 cut(s)	37, 113
BtsCI	GGATG	1 cut(s)	56
BtsI	GCAGTG	1 cut(s)	213
BtsIMutI	CAGTG	1 cut(s)	213
Cfr10I	RCCGGY	1 cut(s)	37
Cfr13I	GGNCC	1 cut(s)	35
Cfr9I	CCCGGG	1 cut(s)	450
CviAII	CATG	2 cut(s)	19, 73
CviJI	RGCY	8 cut(s)	37, 113, 134, 176, 187, 252, 295, 305
CviKI_1	RGCY	8 cut(s)	37, 113, 134, 176, 187, 252, 295, 305
DdeI	CTNAG	2 cut(s)	120, 183
DpnI	GATC	1 cut(s)	311
DpnII	GATC	1 cut(s)	309
Eam1104I	CTCTTC	1 cut(s)	60
EarI	CTCTTC	1 cut(s)	60
Eco130I	CCWWGG	2 cut(s)	5, 269
Eco31I	GGTCTC	2 cut(s)	62, 137
Eco88I	CYCGRG	1 cut(s)	450
EcoT14I	CCWWGG	2 cut(s)	5, 269
ErhI	CCWWGG	2 cut(s)	5, 269
FaeI	CATG	2 cut(s)	22, 76
FaiI	YATR	4 cut(s)	20, 74, 299, 341
FatI	CATG	2 cut(s)	18, 72
FbaI	TGATCA	1 cut(s)	309
Fnu4HI	GCNGC	2 cut(s)	77, 158
FokI	GGATG	1 cut(s)	43
Fsp4HI	GCNGC	2 cut(s)	77, 158
FspBI	CTAG	2 cut(s)	188, 249
GluI	GCNGC	2 cut(s)	77, 158
HaeIII	GGCC	2 cut(s)	37, 113
HapII	CCGG	2 cut(s)	38, 451
Hin1II	CATG	2 cut(s)	22, 76
HinfI	GANTC	3 cut(s)	10, 401, 416
HpaII	CCGG	2 cut(s)	38, 451
Hpy166II	GTNNAC	1 cut(s)	245
Hpy188I	TCNGA	3 cut(s)	96, 123, 207
Hpy188III	TCNNGA	2 cut(s)	140, 477
Hpy8I	GTNNAC	1 cut(s)	245
HpyAV	CCTTC	1 cut(s)	406
HpyCH4V	TGCA	5 cut(s)	22, 76, 86, 439, 466
HpyF3I	CTNAG	2 cut(s)	120, 183
Hsp92II	CATG	2 cut(s)	22, 76
Ksp22I	TGATCA	1 cut(s)	309
Kzo9I	GATC	1 cut(s)	309
LmnI	GCTCC	1 cut(s)	292
LpnPI	CCDG	5 cut(s)	51, 125, 275, 402, 464
Lsp1109I	GCAGC	2 cut(s)	88, 169
LweI	GCATC	1 cut(s)	114
MaeI	CTAG	2 cut(s)	188, 249
MalI	GATC	1 cut(s)	311
MboI	GATC	1 cut(s)	309
MboII	GAAGA	2 cut(s)	77, 380
MluCI	AATT	4 cut(s)	25, 101, 278, 393
MnlI	CCTC	3 cut(s)	24, 312, 418
MseI	TTAA	1 cut(s)	396
MspI	CCGG	2 cut(s)	38, 451
MspR9I	CCNGG	2 cut(s)	451, 452
NciI	CCSGG	2 cut(s)	451, 452
NdeII	GATC	1 cut(s)	309
NlaIII	CATG	2 cut(s)	22, 76
NlaIV	GGNNCC	1 cut(s)	294
PfeI	GAWTC	3 cut(s)	10, 401, 416
PkrI	GCNGC	2 cut(s)	78, 159
PshBI	ATTAAT	1 cut(s)	396
PspN4I	GGNNCC	1 cut(s)	294
PspPI	GGNCC	1 cut(s)	35
SaqAI	TTAA	1 cut(s)	396
SatI	GCNGC	2 cut(s)	77, 158
Sau3AI	GATC	1 cut(s)	309
Sau96I	GGNCC	1 cut(s)	35
ScrFI	CCNGG	2 cut(s)	451, 452
SetI	ASST	5 cut(s)	136, 178, 189, 250, 307
SfaNI	GCATC	1 cut(s)	114
SmaI	CCCGGG	1 cut(s)	452
SmlI	CTYRAG	1 cut(s)	171
SmoI	CTYRAG	1 cut(s)	171
Sse9I	AATT	4 cut(s)	25, 101, 278, 393
SspMI	CTAG	2 cut(s)	188, 249
StyD4I	CCNGG	2 cut(s)	449, 450
StyI	CCWWGG	2 cut(s)	5, 269
TasI	AATT	4 cut(s)	25, 101, 278, 393
TfiI	GAWTC	3 cut(s)	10, 401, 416
Tru1I	TTAA	1 cut(s)	396
Tru9I	TTAA	1 cut(s)	396
TscAI	CASTG	1 cut(s)	220
TseI	GCWGC	2 cut(s)	76, 157
TspDTI	ATGAA	2 cut(s)	314, 414
TspMI	CCCGGG	1 cut(s)	450
TspRI	CASTG	1 cut(s)	220
VspI	ATTAAT	1 cut(s)	396
XapI	RAATTY	1 cut(s)	101
XmaI	CCCGGG	1 cut(s)	450
XspI	CTAG	2 cut(s)	188, 249

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.