Rmu_sc0004717.1_g000001

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004717.1
OG0012570
Physical Location & Seq
Forward (+)
329 .. 808
480 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004717.1_g000001.1.cds

Sequence Viewer

Length: 480 bp
atgcagcaacttgcacaaaatcagatggaatttcaaaaggctaatgctcaaatgcttcaagctattcaagagaccaagaaagagcaacaagttcaatctcaagctatttctaagctagaagttcaagttggccagattgccactgctttgaatgagagagaacaagggcgtttacctagccaaactcttgctaatccaaggggtcaatttgagcaacatgagcctatgaaagctgtaatcacattgaggagtggaaaagaagttgatataaaagttcgtagtccaagagataaagaagaagtcaaacggggaaacccagaaattaatgaatcagcagagaaggaatctgcagaaggattgaagctgcaacagcaatcccgaaaacgaactgattcgaacccaacgacttctagcaccccagaaacgactttaaggtctactccagagtctcactttgttcctaaacctccatatccatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Asp_protease_2 Retrotrans_gag

Protein Analysis

159

Amino Acids

17.95

Weight (kDa)

8.89

Isoelectric Point (pI)

57.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 433
AccI GTMKAC 1 cut(s) 437
AcoI YGGCCR 1 cut(s) 130
AcsI RAATTY 1 cut(s) 29
AgsI TTSAA 7 cut(s) 35, 59, 68, 95, 125, 151, 361
AjuI GAANNNNNNNTTGG 2 cut(s) 111, 143
AluBI AGCT 5 cut(s) 62, 104, 115, 233, 364
AluI AGCT 5 cut(s) 62, 104, 115, 233, 364
Alw26I GTCTC 2 cut(s) 65, 453
AoxI GGCC 1 cut(s) 130
ApeKI GCWGC 2 cut(s) 4, 364
ApoI RAATTY 1 cut(s) 29
AseI ATTAAT 1 cut(s) 324
Asp700I GAANNNNTTC 1 cut(s) 391
AsuII TTCGAA 1 cut(s) 395
BalI TGGCCA 1 cut(s) 132
BbvI GCAGC 2 cut(s) 16, 351
BccI CCATC 1 cut(s) 19
BcoDI GTCTC 2 cut(s) 65, 453
BfaI CTAG 3 cut(s) 116, 177, 411
BfmI CTRYAG 1 cut(s) 348
BisI GCNGC 2 cut(s) 5, 365
BlsI GCNGC 2 cut(s) 6, 366
BpmI CTGGAG 1 cut(s) 426
Bpu14I TTCGAA 1 cut(s) 395
BpuEI CTTGAG 1 cut(s) 84
BsaI GGTCTC 1 cut(s) 65
BsaJI CCNNGG 1 cut(s) 197
BseDI CCNNGG 1 cut(s) 197
BseRI GAGGAG 1 cut(s) 262
BseXI GCAGC 2 cut(s) 16, 351
BshFI GGCC 1 cut(s) 132
BsmAI GTCTC 2 cut(s) 65, 453
BsnI GGCC 1 cut(s) 132
Bso31I GGTCTC 1 cut(s) 65
Bsp119I TTCGAA 1 cut(s) 395
BspANI GGCC 1 cut(s) 132
BspMAI CTGCAG 1 cut(s) 352
BspT104I TTCGAA 1 cut(s) 395
BspTNI GGTCTC 1 cut(s) 65
BssECI CCNNGG 1 cut(s) 197
BssT1I CCWWGG 1 cut(s) 197
BstBI TTCGAA 1 cut(s) 395
BstDEI CTNAG 1 cut(s) 111
BstMAI GTCTC 2 cut(s) 65, 453
BstMWI GCNNNNNNNGC 2 cut(s) 220, 370
BstSFI CTRYAG 1 cut(s) 348
BstV1I GCAGC 2 cut(s) 16, 351
BsuRI GGCC 1 cut(s) 132
BtsI GCAGTG 1 cut(s) 141
BtsIMutI CAGTG 1 cut(s) 141
CviAII CATG 1 cut(s) 218
CviJI RGCY 9 cut(s) 41, 62, 104, 115, 132, 180, 223, 233, 364
CviKI_1 RGCY 9 cut(s) 41, 62, 104, 115, 132, 180, 223, 233, 364
DdeI CTNAG 1 cut(s) 111
DrdI GACNNNNNNGTC 1 cut(s) 433
DseDI GACNNNNNNGTC 1 cut(s) 433
EaeI YGGCCR 1 cut(s) 130
Eco130I CCWWGG 1 cut(s) 197
Eco31I GGTCTC 1 cut(s) 65
EcoT14I CCWWGG 1 cut(s) 197
ErhI CCWWGG 1 cut(s) 197
FaeI CATG 1 cut(s) 221
FaiI YATR 5 cut(s) 219, 227, 269, 472, 478
FatI CATG 1 cut(s) 217
FblI GTMKAC 1 cut(s) 437
Fnu4HI GCNGC 2 cut(s) 5, 365
Fsp4HI GCNGC 2 cut(s) 5, 365
FspBI CTAG 3 cut(s) 116, 177, 411
GluI GCNGC 2 cut(s) 5, 365
GsuI CTGGAG 1 cut(s) 426
HaeIII GGCC 1 cut(s) 132
Hin1II CATG 1 cut(s) 221
HinfI GANTC 4 cut(s) 329, 344, 392, 446
Hpy166II GTNNAC 2 cut(s) 173, 438
Hpy188I TCNGA 1 cut(s) 24
Hpy188III TCNNGA 3 cut(s) 68, 378, 443
Hpy8I GTNNAC 2 cut(s) 173, 438
HpyAV CCTTC 2 cut(s) 334, 347
HpyCH4V TGCA 4 cut(s) 4, 14, 350, 367
HpyF10VI GCNNNNNNNGC 2 cut(s) 220, 370
HpyF3I CTNAG 1 cut(s) 111
Hsp92II CATG 1 cut(s) 221
LpnPI CCDG 4 cut(s) 146, 330, 432, 456
Lsp1109I GCAGC 2 cut(s) 16, 351
MaeI CTAG 3 cut(s) 116, 177, 411
MboII GAAGA 1 cut(s) 308
MlsI TGGCCA 1 cut(s) 132
MluCI AATT 3 cut(s) 29, 206, 321
MluNI TGGCCA 1 cut(s) 132
MlyI GAGTC 1 cut(s) 455
MnlI CCTC 2 cut(s) 240, 477
Mox20I TGGCCA 1 cut(s) 132
MroXI GAANNNNTTC 1 cut(s) 391
MscI TGGCCA 1 cut(s) 132
MseI TTAA 2 cut(s) 324, 431
Msp20I TGGCCA 1 cut(s) 132
MwoI GCNNNNNNNGC 2 cut(s) 220, 370
NlaIII CATG 1 cut(s) 221
NspV TTCGAA 1 cut(s) 395
PcsI WCGNNNNNNNCGW 1 cut(s) 401
PdmI GAANNNNTTC 1 cut(s) 391
PfeI GAWTC 3 cut(s) 329, 344, 392
PkrI GCNGC 2 cut(s) 6, 366
PleI GAGTC 1 cut(s) 454
PpsI GAGTC 1 cut(s) 454
PshBI ATTAAT 1 cut(s) 324
PstI CTGCAG 1 cut(s) 352
SaqAI TTAA 2 cut(s) 324, 431
SatI GCNGC 2 cut(s) 5, 365
SchI GAGTC 1 cut(s) 455
SetI ASST 8 cut(s) 64, 106, 117, 178, 235, 366, 437, 469
SfcI CTRYAG 1 cut(s) 348
SfuI TTCGAA 1 cut(s) 395
SmlI CTYRAG 1 cut(s) 99
SmoI CTYRAG 1 cut(s) 99
Sse9I AATT 3 cut(s) 29, 206, 321
SspMI CTAG 3 cut(s) 116, 177, 411
StyI CCWWGG 1 cut(s) 197
TaqI TCGA 1 cut(s) 395
TasI AATT 3 cut(s) 29, 206, 321
TfiI GAWTC 3 cut(s) 329, 344, 392
Tru1I TTAA 2 cut(s) 324, 431
Tru9I TTAA 2 cut(s) 324, 431
TscAI CASTG 1 cut(s) 148
TseI GCWGC 2 cut(s) 4, 364
TspDTI ATGAA 2 cut(s) 242, 342
TspRI CASTG 1 cut(s) 148
VspI ATTAAT 1 cut(s) 324
XapI RAATTY 1 cut(s) 29
XmiI GTMKAC 1 cut(s) 437
XmnI GAANNNNTTC 1 cut(s) 391
XspI CTAG 3 cut(s) 116, 177, 411
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.