Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001296.1

Orthogroup ID

OG0012570

Physical Location & Seq

Genomic Coordinates Reverse (-)

49924 .. 50799

Gene Structure 876 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001296.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 876 bp

atggtggatgctatagttggtggaagcttgatgggaaagacggcagaagaagcaattcaagtttttgagactatatgtgaaaattcgcagcaatatgatccttacacatcagtgcccaaaagaggaggactatatgaggttagtgcaaatactaagttggaagagcaagttgcagccttggcaagacaaatgaagagccttactcctctgttacataaggctacaagggagacatgtgctttgtgttcaaatattgtgtataccacagaggcttgtcctgaaaatttcttccaagatgagcaagtcaacatggtgaataattatagaaggcctgtgaatgatcttttttcaaatacctataatccatgttggagacaacatccaaatttctcttatagaaacaataatcaagtgcagatgccaaggaatcctcccatgcaaaattatcaagggccaattgaacaaaagaaaccatctcttgaagaaaacatgcagcaacttgcacaaaatcagatgaaatttcaaaaggccaaggctcagatgcttcaagctattcaagagaccaagaaagagcagcaagttcaatctcaagctatttctaagcgagaagttcaagttggacagattgccactgccttgaatgagagagaacaagggcgtttacctagccaaactcttgctaatccaaggggtcaatttgagaaacatgagcctgtgaaagctgtgatcacgttgaggagtggaaaagaagttgatattaaagttcgtagtccaagagataaagaagaagccaaacgggggaacccagaaattaaggaatcaggagagaaggaatcagcagaaggattgaagctgcaacagcaatcccaaaaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Asp_protease_2 RVT_1 Retrotrans_gag rve

Protein Analysis

291

Amino Acids

33.13

Weight (kDa)

8.68

Isoelectric Point (pI)

47.39

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012570)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g29683 FvH4_1g29684 FvH4_4g02083
pyrus_communis	pycom12g06170
rosa_chinensis	RchiOBHm_Chr2g0131801
rosa_multiflora	Rmu_sc0000319.1_g000006 Rmu_sc0001296.1_g000010 Rmu_sc0002563.1_g000042 Rmu_sc0004717.1_g000001 Rmu_sc0023614.1_g000002
rosa_roxburghii	Rroxscaffold_1G00045600 Rroxscaffold_2G00076110 Rroxscaffold_3G00230440 Rroxscaffold_5G00347270 Rroxscaffold_5G00366690 Rroxscaffold_5G00385080 Rroxscaffold_7G00167830 Rroxscaffold_7G00203970 Rroxscaffold_7G00207850

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	260
AclWI	GGATC	1 cut(s)	92
AcsI	RAATTY	4 cut(s)	82, 283, 385, 518
AfiI	CCNNNNNNNGG	2 cut(s)	122, 798
AflIII	ACRYGT	1 cut(s)	233
AjuI	GAANNNNNNNTTGG	2 cut(s)	600, 632
AleI	CACNNNNGTG	1 cut(s)	110
AluBI	AGCT	5 cut(s)	27, 551, 593, 722, 853
AluI	AGCT	5 cut(s)	27, 551, 593, 722, 853
Alw26I	GTCTC	4 cut(s)	62, 224, 367, 554
AlwI	GGATC	1 cut(s)	92
AoxI	GGCC	3 cut(s)	329, 452, 528
ApeKI	GCWGC	5 cut(s)	88, 173, 493, 574, 853
ApoI	RAATTY	4 cut(s)	82, 283, 385, 518
ArsI	GACNNNNNNTTYG	2 cut(s)	223, 255
Asp700I	GAANNNNTTC	1 cut(s)	54
AspS9I	GGNCC	1 cut(s)	452
AsuHPI	GGTGA	1 cut(s)	325
BaeGI	GKGCMC	1 cut(s)	117
BbvI	GCAGC	5 cut(s)	100, 185, 505, 586, 840
BccI	CCATC	2 cut(s)	25, 481
BceAI	ACGGC	1 cut(s)	57
BclI	TGATCA	1 cut(s)	726
BcoDI	GTCTC	4 cut(s)	62, 224, 367, 554
BfaI	CTAG	1 cut(s)	666
BfmI	CTRYAG	1 cut(s)	12
BisI	GCNGC	5 cut(s)	89, 174, 494, 575, 854
BlsI	GCNGC	5 cut(s)	90, 175, 495, 576, 855
BmgT120I	GGNCC	1 cut(s)	452
BmiI	GGNNCC	1 cut(s)	803
BmsI	GCATC	2 cut(s)	408, 531
BplI	GAGNNNNNCTC	2 cut(s)	187, 219
BpuEI	CTTGAG	1 cut(s)	573
BsaI	GGTCTC	1 cut(s)	554
BsaJI	CCNNGG	4 cut(s)	177, 422, 531, 686
Bsc4I	CCNNNNNNNGG	2 cut(s)	122, 798
BseDI	CCNNGG	4 cut(s)	177, 422, 531, 686
BseGI	GGATG	2 cut(s)	13, 379
BseLI	CCNNNNNNNGG	2 cut(s)	122, 798
BseMII	CTCAG	1 cut(s)	551
BseRI	GAGGAG	3 cut(s)	138, 195, 751
BseSI	GKGCMC	1 cut(s)	117
BseXI	GCAGC	5 cut(s)	100, 185, 505, 586, 840
BsgI	GTGCAG	1 cut(s)	434
BshFI	GGCC	3 cut(s)	331, 454, 530
BslI	CCNNNNNNNGG	2 cut(s)	122, 798
BsmAI	GTCTC	4 cut(s)	62, 224, 367, 554
BsnI	GGCC	3 cut(s)	331, 454, 530
Bso31I	GGTCTC	1 cut(s)	554
Bsp1286I	GDGCHC	1 cut(s)	117
Bsp143I	GATC	3 cut(s)	97, 340, 726
BspANI	GGCC	3 cut(s)	331, 454, 530
BspCNI	CTCAG	1 cut(s)	550
BspLI	GGNNCC	1 cut(s)	803
BspPI	GGATC	1 cut(s)	92
BspQI	GCTCTTC	2 cut(s)	156, 188
BspTNI	GGTCTC	1 cut(s)	554
BssECI	CCNNGG	4 cut(s)	177, 422, 531, 686
BssMI	GATC	3 cut(s)	97, 340, 726
BssNAI	GTATAC	1 cut(s)	261
BssT1I	CCWWGG	4 cut(s)	177, 422, 531, 686
Bst1107I	GTATAC	1 cut(s)	261
Bst6I	CTCTTC	2 cut(s)	156, 188
BstDEI	CTNAG	3 cut(s)	153, 537, 600
BstF5I	GGATG	2 cut(s)	13, 379
BstKTI	GATC	3 cut(s)	100, 343, 729
BstMAI	GTCTC	4 cut(s)	62, 224, 367, 554
BstMBI	GATC	3 cut(s)	97, 340, 726
BstMWI	GCNNNNNNNGC	3 cut(s)	50, 179, 859
BstNSI	RCATGY	2 cut(s)	237, 493
BstSFI	CTRYAG	1 cut(s)	12
BstSLI	GKGCMC	1 cut(s)	117
BstV1I	GCAGC	5 cut(s)	100, 185, 505, 586, 840
BstZ17I	GTATAC	1 cut(s)	261
BsuRI	GGCC	3 cut(s)	331, 454, 530
BtsCI	GGATG	2 cut(s)	13, 379
BtsI	GCAGTG	1 cut(s)	630
BtsIMutI	CAGTG	2 cut(s)	117, 630
Cfr13I	GGNCC	1 cut(s)	452
CviAII	CATG	6 cut(s)	234, 310, 366, 436, 490, 707
DdeI	CTNAG	3 cut(s)	153, 537, 600
DpnI	GATC	3 cut(s)	99, 342, 728
DpnII	GATC	3 cut(s)	97, 340, 726
Eam1104I	CTCTTC	2 cut(s)	156, 188
EarI	CTCTTC	2 cut(s)	156, 188
Eco130I	CCWWGG	4 cut(s)	177, 422, 531, 686
Eco147I	AGGCCT	1 cut(s)	331
Eco31I	GGTCTC	1 cut(s)	554
EcoT14I	CCWWGG	4 cut(s)	177, 422, 531, 686
ErhI	CCWWGG	4 cut(s)	177, 422, 531, 686
FaeI	CATG	6 cut(s)	237, 313, 369, 439, 493, 710
FatI	CATG	6 cut(s)	233, 309, 365, 435, 489, 706
FbaI	TGATCA	1 cut(s)	726
FblI	GTMKAC	1 cut(s)	260
Fnu4HI	GCNGC	5 cut(s)	89, 174, 494, 575, 854
FokI	GGATG	2 cut(s)	20, 366
Fsp4HI	GCNGC	5 cut(s)	89, 174, 494, 575, 854
FspBI	CTAG	1 cut(s)	666
GluI	GCNGC	5 cut(s)	89, 174, 494, 575, 854
HaeIII	GGCC	3 cut(s)	331, 454, 530
Hin1II	CATG	6 cut(s)	237, 313, 369, 439, 493, 710
HincII	GTYRAC	1 cut(s)	307
HindII	GTYRAC	1 cut(s)	307
HindIII	AAGCTT	1 cut(s)	25
HinfI	GANTC	3 cut(s)	427, 818, 833
HphI	GGTGA	1 cut(s)	325
Hpy166II	GTNNAC	3 cut(s)	261, 307, 662
Hpy188I	TCNGA	2 cut(s)	513, 540
Hpy188III	TCNNGA	4 cut(s)	278, 479, 557, 822
Hpy8I	GTNNAC	3 cut(s)	261, 307, 662
HpyAV	CCTTC	3 cut(s)	321, 823, 836
HpyCH4IV	ACGT	1 cut(s)	731
HpyCH4V	TGCA	7 cut(s)	146, 173, 415, 439, 493, 503, 856
HpyF10VI	GCNNNNNNNGC	3 cut(s)	50, 179, 859
HpyF3I	CTNAG	3 cut(s)	153, 537, 600
HpySE526I	ACGT	1 cut(s)	731
Hsp92II	CATG	6 cut(s)	237, 313, 369, 439, 493, 710
Ksp22I	TGATCA	1 cut(s)	726
Kzo9I	GATC	3 cut(s)	97, 340, 726
LguI	GCTCTTC	2 cut(s)	156, 188
LpnPI	CCDG	5 cut(s)	291, 345, 726, 807, 819
Lsp1109I	GCAGC	5 cut(s)	100, 185, 505, 586, 840
LweI	GCATC	2 cut(s)	408, 531
MaeI	CTAG	1 cut(s)	666
MaeII	ACGT	1 cut(s)	731
MaeIII	GTNAC	1 cut(s)	210
MalI	GATC	3 cut(s)	99, 342, 728
MboI	GATC	3 cut(s)	97, 340, 726
MboII	GAAGA	6 cut(s)	59, 173, 205, 280, 494, 797
MfeI	CAATTG	1 cut(s)	456
MhlI	GDGCHC	1 cut(s)	117
MmeI	TCCRAC	3 cut(s)	138, 350, 598
MnlI	CCTC	7 cut(s)	116, 119, 130, 216, 262, 441, 729
MroXI	GAANNNNTTC	1 cut(s)	54
MseI	TTAA	2 cut(s)	759, 813
MslI	CAYNNNNRTG	1 cut(s)	110
MunI	CAATTG	1 cut(s)	456
MwoI	GCNNNNNNNGC	3 cut(s)	50, 179, 859
NdeII	GATC	3 cut(s)	97, 340, 726
NlaIII	CATG	6 cut(s)	237, 313, 369, 439, 493, 710
NlaIV	GGNNCC	1 cut(s)	803
NspI	RCATGY	2 cut(s)	237, 493
OliI	CACNNNNGTG	1 cut(s)	110
PceI	AGGCCT	1 cut(s)	331
PciI	ACATGT	1 cut(s)	233
PciSI	GCTCTTC	2 cut(s)	156, 188
PdmI	GAANNNNTTC	1 cut(s)	54
PfeI	GAWTC	3 cut(s)	427, 818, 833
PkrI	GCNGC	5 cut(s)	90, 175, 495, 576, 855
PscI	ACATGT	1 cut(s)	233
PspN4I	GGNNCC	1 cut(s)	803
PspPI	GGNCC	1 cut(s)	452
RseI	CAYNNNNRTG	1 cut(s)	110
SapI	GCTCTTC	2 cut(s)	156, 188
SaqAI	TTAA	2 cut(s)	759, 813
SatI	GCNGC	5 cut(s)	89, 174, 494, 575, 854
Sau3AI	GATC	3 cut(s)	97, 340, 726
Sau96I	GGNCC	1 cut(s)	452
SduI	GDGCHC	1 cut(s)	117
SetI	ASST	9 cut(s)	29, 141, 359, 553, 595, 667, 724, 734, 855
SfaNI	GCATC	2 cut(s)	408, 531
SfcI	CTRYAG	1 cut(s)	12
SmiMI	CAYNNNNRTG	1 cut(s)	110
SmlI	CTYRAG	1 cut(s)	588
SmoI	CTYRAG	1 cut(s)	588
SseBI	AGGCCT	1 cut(s)	331
SspI	AATATT	1 cut(s)	253
SspMI	CTAG	1 cut(s)	666
StuI	AGGCCT	1 cut(s)	331
StyI	CCWWGG	4 cut(s)	177, 422, 531, 686
TaiI	ACGT	1 cut(s)	734
TfiI	GAWTC	3 cut(s)	427, 818, 833
Tru1I	TTAA	2 cut(s)	759, 813
Tru9I	TTAA	2 cut(s)	759, 813
TscAI	CASTG	2 cut(s)	117, 637
TseI	GCWGC	5 cut(s)	88, 173, 493, 574, 853
TspDTI	ATGAA	2 cut(s)	206, 530
TspRI	CASTG	2 cut(s)	117, 637
XapI	RAATTY	4 cut(s)	82, 283, 385, 518
XceI	RCATGY	2 cut(s)	237, 493
XmiI	GTMKAC	1 cut(s)	260
XmnI	GAANNNNTTC	1 cut(s)	54
XspI	CTAG	1 cut(s)	666

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.