Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002563.1

Orthogroup ID

OG0012570

Physical Location & Seq

Genomic Coordinates Forward (+)

127197 .. 128161

Gene Structure 965 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002563.1_g000042.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 861 bp

atggtggatgctacagttgatggaagcttgatgggaaagatggcagatgaggcaattcaagcttttgagactatatgtgaaaattcgcagcaatatgatccttatataacagtgcccaaaagaggaggactatatgaggttagtgcaagtactaagttggaagagcaagttgcaaccttggcaagacaaatgaagagccttactcctctgttaaataaggctgcaagggagacatgtgcttcgtgttcaagtattgcacataccacagaggcttgtcccgaaaatttcttccaagatgagcaagtcaacatggtgaataattatagaaggcctatgaatgatcctttttcaaatacatataatccagaaaccatgcagcaacttgcacaaaatcatatggaatttcaaaaggccaatgctcagatgcttcaagctattcaagagaccaagaaagagcagcaagttcaatctcaagctatttctaagctagaagttcaagttggtcagattgccactgctttgaatgagagagaacaagggcgtttacctagccaaactcttgctaatccaaggggtcaatttgagaaacatgagcctatgaaagctgtgatcacattgaggagtggaaaagaagttgatataaaagttcgtagtccaagagataaagaagaagtcaaacggggaaacccagaaattaatgaatcagcagagaaggaatctgcagaaggattgaagctgcaacagcaatcccgaaaacgaactgattcgaacccagcaacgtctagcaccccagaaacgactttaaggtctacttcaaagtctcaattttttcccaaacctccatatccagaattgctttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Asp_protease_2 RVT_1 Retrotrans_gag rve

Protein Analysis

286

Amino Acids

32.1

Weight (kDa)

5.83

Isoelectric Point (pI)

51.02

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012570)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g29683 FvH4_1g29684 FvH4_4g02083
pyrus_communis	pycom12g06170
rosa_chinensis	RchiOBHm_Chr2g0131801
rosa_multiflora	Rmu_sc0000319.1_g000006 Rmu_sc0001296.1_g000010 Rmu_sc0002563.1_g000042 Rmu_sc0004717.1_g000001 Rmu_sc0023614.1_g000002
rosa_roxburghii	Rroxscaffold_1G00045600 Rroxscaffold_2G00076110 Rroxscaffold_3G00230440 Rroxscaffold_5G00347270 Rroxscaffold_5G00366690 Rroxscaffold_5G00385080 Rroxscaffold_7G00167830 Rroxscaffold_7G00203970 Rroxscaffold_7G00207850

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	805
AccI	GTMKAC	1 cut(s)	809
AclWI	GGATC	2 cut(s)	92, 335
AcsI	RAATTY	3 cut(s)	82, 283, 401
AfaI	GTAC	1 cut(s)	151
AfiI	CCNNNNNNNGG	1 cut(s)	122
AflIII	ACRYGT	1 cut(s)	233
AjuI	GAANNNNNNNTTGG	2 cut(s)	483, 515
AluBI	AGCT	7 cut(s)	27, 62, 434, 476, 487, 605, 736
AluI	AGCT	7 cut(s)	27, 62, 434, 476, 487, 605, 736
Alw26I	GTCTC	4 cut(s)	62, 224, 437, 825
AlwI	GGATC	2 cut(s)	92, 335
AoxI	GGCC	2 cut(s)	329, 411
ApeKI	GCWGC	5 cut(s)	88, 221, 376, 457, 736
ApoI	RAATTY	3 cut(s)	82, 283, 401
ArsI	GACNNNNNNTTYG	2 cut(s)	223, 255
AseI	ATTAAT	1 cut(s)	696
Asp700I	GAANNNNTTC	1 cut(s)	763
AsuHPI	GGTGA	1 cut(s)	325
AsuII	TTCGAA	1 cut(s)	767
BaeGI	GKGCMC	1 cut(s)	117
BbvI	GCAGC	5 cut(s)	100, 208, 388, 469, 723
BccI	CCATC	3 cut(s)	14, 25, 34
BclI	TGATCA	1 cut(s)	609
BcoDI	GTCTC	4 cut(s)	62, 224, 437, 825
BfaI	CTAG	3 cut(s)	488, 549, 783
BfmI	CTRYAG	2 cut(s)	12, 720
BisI	GCNGC	5 cut(s)	89, 222, 377, 458, 737
BlsI	GCNGC	5 cut(s)	90, 223, 378, 459, 738
BmcAI	AGTACT	1 cut(s)	151
BmsI	GCATC	1 cut(s)	414
BplI	GAGNNNNNCTC	2 cut(s)	187, 219
Bpu14I	TTCGAA	1 cut(s)	767
BpuEI	CTTGAG	1 cut(s)	456
BsaI	GGTCTC	1 cut(s)	437
BsaJI	CCNNGG	2 cut(s)	177, 569
Bsc4I	CCNNNNNNNGG	1 cut(s)	122
BseDI	CCNNGG	2 cut(s)	177, 569
BseGI	GGATG	1 cut(s)	13
BseLI	CCNNNNNNNGG	1 cut(s)	122
BseMII	CTCAG	1 cut(s)	434
BseRI	GAGGAG	3 cut(s)	138, 195, 634
BseSI	GKGCMC	1 cut(s)	117
BseXI	GCAGC	5 cut(s)	100, 208, 388, 469, 723
BseYI	CCCAGC	1 cut(s)	772
BshFI	GGCC	2 cut(s)	331, 413
BslFI	GGGAC	1 cut(s)	261
BslI	CCNNNNNNNGG	1 cut(s)	122
BsmAI	GTCTC	4 cut(s)	62, 224, 437, 825
BsmFI	GGGAC	1 cut(s)	261
BsnI	GGCC	2 cut(s)	331, 413
Bso31I	GGTCTC	1 cut(s)	437
Bsp119I	TTCGAA	1 cut(s)	767
Bsp1286I	GDGCHC	1 cut(s)	117
Bsp143I	GATC	3 cut(s)	97, 340, 609
BspANI	GGCC	2 cut(s)	331, 413
BspCNI	CTCAG	1 cut(s)	433
BspMAI	CTGCAG	1 cut(s)	724
BspPI	GGATC	2 cut(s)	92, 335
BspQI	GCTCTTC	2 cut(s)	156, 188
BspT104I	TTCGAA	1 cut(s)	767
BspTNI	GGTCTC	1 cut(s)	437
BssECI	CCNNGG	2 cut(s)	177, 569
BssMI	GATC	3 cut(s)	97, 340, 609
BssT1I	CCWWGG	2 cut(s)	177, 569
Bst4CI	ACNGT	2 cut(s)	16, 112
Bst6I	CTCTTC	2 cut(s)	156, 188
BstBI	TTCGAA	1 cut(s)	767
BstDEI	CTNAG	3 cut(s)	153, 420, 483
BstF5I	GGATG	1 cut(s)	13
BstKTI	GATC	3 cut(s)	100, 343, 612
BstMAI	GTCTC	4 cut(s)	62, 224, 437, 825
BstMBI	GATC	3 cut(s)	97, 340, 609
BstMWI	GCNNNNNNNGC	4 cut(s)	50, 59, 179, 742
BstNSI	RCATGY	1 cut(s)	237
BstSFI	CTRYAG	2 cut(s)	12, 720
BstSLI	GKGCMC	1 cut(s)	117
BstV1I	GCAGC	5 cut(s)	100, 208, 388, 469, 723
BsuRI	GGCC	2 cut(s)	331, 413
BtsCI	GGATG	1 cut(s)	13
BtsI	GCAGTG	1 cut(s)	513
BtsIMutI	CAGTG	2 cut(s)	117, 513
Csp6I	GTAC	1 cut(s)	150
CviAII	CATG	4 cut(s)	234, 310, 373, 590
CviQI	GTAC	1 cut(s)	150
DdeI	CTNAG	3 cut(s)	153, 420, 483
DpnI	GATC	3 cut(s)	99, 342, 611
DpnII	GATC	3 cut(s)	97, 340, 609
DrdI	GACNNNNNNGTC	1 cut(s)	805
DseDI	GACNNNNNNGTC	1 cut(s)	805
Eam1104I	CTCTTC	2 cut(s)	156, 188
EarI	CTCTTC	2 cut(s)	156, 188
Eco130I	CCWWGG	2 cut(s)	177, 569
Eco147I	AGGCCT	1 cut(s)	331
Eco31I	GGTCTC	1 cut(s)	437
EcoT14I	CCWWGG	2 cut(s)	177, 569
ErhI	CCWWGG	2 cut(s)	177, 569
FaeI	CATG	4 cut(s)	237, 313, 376, 593
FalI	AAGNNNNNCTT	2 cut(s)	796, 828
FaqI	GGGAC	1 cut(s)	261
FatI	CATG	4 cut(s)	233, 309, 372, 589
FauNDI	CATATG	1 cut(s)	396
FbaI	TGATCA	1 cut(s)	609
FblI	GTMKAC	1 cut(s)	809
Fnu4HI	GCNGC	5 cut(s)	89, 222, 377, 458, 737
FokI	GGATG	1 cut(s)	20
Fsp4HI	GCNGC	5 cut(s)	89, 222, 377, 458, 737
FspBI	CTAG	3 cut(s)	488, 549, 783
GluI	GCNGC	5 cut(s)	89, 222, 377, 458, 737
GsaI	CCCAGC	1 cut(s)	776
HaeIII	GGCC	2 cut(s)	331, 413
Hin1II	CATG	4 cut(s)	237, 313, 376, 593
HincII	GTYRAC	1 cut(s)	307
HindII	GTYRAC	1 cut(s)	307
HindIII	AAGCTT	2 cut(s)	25, 60
HinfI	GANTC	3 cut(s)	701, 716, 764
HphI	GGTGA	1 cut(s)	325
Hpy166II	GTNNAC	3 cut(s)	307, 545, 810
Hpy188I	TCNGA	2 cut(s)	423, 507
Hpy188III	TCNNGA	5 cut(s)	278, 365, 440, 750, 848
Hpy8I	GTNNAC	3 cut(s)	307, 545, 810
HpyAV	CCTTC	3 cut(s)	321, 706, 719
HpyCH4III	ACNGT	2 cut(s)	16, 112
HpyCH4IV	ACGT	1 cut(s)	779
HpyCH4V	TGCA	8 cut(s)	146, 173, 224, 257, 376, 386, 722, 739
HpyF10VI	GCNNNNNNNGC	4 cut(s)	50, 59, 179, 742
HpyF3I	CTNAG	3 cut(s)	153, 420, 483
HpySE526I	ACGT	1 cut(s)	779
Hsp92II	CATG	4 cut(s)	237, 313, 376, 593
Ksp22I	TGATCA	1 cut(s)	609
Kzo9I	GATC	3 cut(s)	97, 340, 609
LguI	GCTCTTC	2 cut(s)	156, 188
LpnPI	CCDG	4 cut(s)	378, 702, 786, 804
Lsp1109I	GCAGC	5 cut(s)	100, 208, 388, 469, 723
LweI	GCATC	1 cut(s)	414
MaeI	CTAG	3 cut(s)	488, 549, 783
MaeII	ACGT	1 cut(s)	779
MalI	GATC	3 cut(s)	99, 342, 611
MboI	GATC	3 cut(s)	97, 340, 609
MboII	GAAGA	4 cut(s)	173, 205, 280, 680
MhlI	GDGCHC	1 cut(s)	117
MluCI	AATT	9 cut(s)	54, 82, 283, 319, 401, 578, 693, 824, 851
MmeI	TCCRAC	1 cut(s)	138
MnlI	CCTC	8 cut(s)	43, 116, 119, 130, 216, 262, 612, 849
MroXI	GAANNNNTTC	1 cut(s)	763
MseI	TTAA	3 cut(s)	212, 696, 803
MwoI	GCNNNNNNNGC	4 cut(s)	50, 59, 179, 742
NdeI	CATATG	1 cut(s)	396
NdeII	GATC	3 cut(s)	97, 340, 609
NlaIII	CATG	4 cut(s)	237, 313, 376, 593
NspI	RCATGY	1 cut(s)	237
NspV	TTCGAA	1 cut(s)	767
PceI	AGGCCT	1 cut(s)	331
PciI	ACATGT	1 cut(s)	233
PciSI	GCTCTTC	2 cut(s)	156, 188
PdmI	GAANNNNTTC	1 cut(s)	763
PfeI	GAWTC	3 cut(s)	701, 716, 764
PkrI	GCNGC	5 cut(s)	90, 223, 378, 459, 738
PscI	ACATGT	1 cut(s)	233
PshBI	ATTAAT	1 cut(s)	696
PspFI	CCCAGC	1 cut(s)	772
PstI	CTGCAG	1 cut(s)	724
RsaI	GTAC	1 cut(s)	151
RsaNI	GTAC	1 cut(s)	150
SapI	GCTCTTC	2 cut(s)	156, 188
SaqAI	TTAA	3 cut(s)	212, 696, 803
SatI	GCNGC	5 cut(s)	89, 222, 377, 458, 737
Sau3AI	GATC	3 cut(s)	97, 340, 609
ScaI	AGTACT	1 cut(s)	151
SduI	GDGCHC	1 cut(s)	117
SfaNI	GCATC	1 cut(s)	414
SfcI	CTRYAG	2 cut(s)	12, 720
SfuI	TTCGAA	1 cut(s)	767
SmlI	CTYRAG	1 cut(s)	471
SmoI	CTYRAG	1 cut(s)	471
Sse9I	AATT	9 cut(s)	54, 82, 283, 319, 401, 578, 693, 824, 851
SseBI	AGGCCT	1 cut(s)	331
SspMI	CTAG	3 cut(s)	488, 549, 783
StuI	AGGCCT	1 cut(s)	331
StyI	CCWWGG	2 cut(s)	177, 569
TaaI	ACNGT	2 cut(s)	16, 112
TaiI	ACGT	1 cut(s)	782
TaqI	TCGA	1 cut(s)	767
TasI	AATT	9 cut(s)	54, 82, 283, 319, 401, 578, 693, 824, 851
TatI	WGTACW	1 cut(s)	149
TfiI	GAWTC	3 cut(s)	701, 716, 764
Tru1I	TTAA	3 cut(s)	212, 696, 803
Tru9I	TTAA	3 cut(s)	212, 696, 803
TscAI	CASTG	2 cut(s)	117, 520
TseI	GCWGC	5 cut(s)	88, 221, 376, 457, 736
TspDTI	ATGAA	4 cut(s)	206, 350, 614, 714
TspRI	CASTG	2 cut(s)	117, 520
VspI	ATTAAT	1 cut(s)	696
XapI	RAATTY	3 cut(s)	82, 283, 401
XceI	RCATGY	1 cut(s)	237
XmiI	GTMKAC	1 cut(s)	809
XmnI	GAANNNNTTC	1 cut(s)	763
XspI	CTAG	3 cut(s)	488, 549, 783
ZrmI	AGTACT	1 cut(s)	151

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.