RchiOBHm_Chr2g0154941

Trafficking protein particle complex subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0004699
Physical Location & Seq
Reverse (-)
71925064 .. 71925228
165 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ52387

Sequence Viewer

Length: 165 bp
ATGGTTTATTTTGGAACAGGAGAGATGCAAGTTACAGCTAGTCATACACGACTTATGCTGCTTTATGACTCCCGTAATGATGACGGGATTAAGAGCTTTTTCCAAGAGGTTCATGAGCTTTATATCAATACTCTTCTTAATCCGACCTACTTGCCTGGTTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Sedlin_N

Protein Analysis

54

Amino Acids

6.21

Weight (kDa)

4.92

Isoelectric Point (pI)

13.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Sedlin_N PF04628 11 - 52 1.1e-11 Sedlin, N-terminal conserved region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 154
AluBI AGCT 3 cut(s) 38, 96, 118
AluI AGCT 3 cut(s) 38, 96, 118
ApeKI GCWGC 1 cut(s) 58
BbvI GCAGC 1 cut(s) 45
BcgI CGANNNNNNTGC 1 cut(s) 133
BciT130I CCWGG 1 cut(s) 156
BfaI CTAG 1 cut(s) 39
BisI GCNGC 1 cut(s) 59
BlsI GCNGC 1 cut(s) 60
Bme1390I CCNGG 1 cut(s) 156
BmrFI CCNGG 1 cut(s) 156
BmsI GCATC 1 cut(s) 15
BseBI CCWGG 1 cut(s) 156
BseXI GCAGC 1 cut(s) 45
BspHI TCATGA 2 cut(s) 112, 161
Bst2UI CCWGG 1 cut(s) 156
Bst6I CTCTTC 1 cut(s) 138
BstNI CCWGG 1 cut(s) 156
BstSCI CCNGG 1 cut(s) 154
BstV1I GCAGC 1 cut(s) 45
CciI TCATGA 2 cut(s) 112, 161
CviAII CATG 2 cut(s) 113, 162
CviJI RGCY 3 cut(s) 38, 96, 118
CviKI_1 RGCY 3 cut(s) 38, 96, 118
Eam1104I CTCTTC 1 cut(s) 138
EarI CTCTTC 1 cut(s) 138
EcoRII CCWGG 1 cut(s) 154
FaeI CATG 2 cut(s) 116, 165
FaiI YATR 6 cut(s) 45, 56, 66, 114, 123, 163
FatI CATG 2 cut(s) 112, 161
Fnu4HI GCNGC 1 cut(s) 59
Fsp4HI GCNGC 1 cut(s) 59
FspBI CTAG 1 cut(s) 39
GluI GCNGC 1 cut(s) 59
Hin1II CATG 2 cut(s) 116, 165
HinfI GANTC 1 cut(s) 68
Hpy188I TCNGA 1 cut(s) 144
Hpy188III TCNNGA 2 cut(s) 113, 162
HpyCH4V TGCA 1 cut(s) 28
Hsp92II CATG 2 cut(s) 116, 165
LpnPI CCDG 2 cut(s) 3, 141
Lsp1109I GCAGC 1 cut(s) 45
LweI GCATC 1 cut(s) 15
MaeI CTAG 1 cut(s) 39
MaeIII GTNAC 1 cut(s) 31
MboII GAAGA 1 cut(s) 125
MlyI GAGTC 1 cut(s) 62
MnlI CCTC 1 cut(s) 100
MseI TTAA 2 cut(s) 90, 138
MspR9I CCNGG 1 cut(s) 156
MvaI CCWGG 1 cut(s) 156
NlaIII CATG 2 cut(s) 116, 165
PagI TCATGA 2 cut(s) 112, 161
PkrI GCNGC 1 cut(s) 60
PleI GAGTC 1 cut(s) 62
PpsI GAGTC 1 cut(s) 62
Psp6I CCWGG 1 cut(s) 154
PspGI CCWGG 1 cut(s) 154
SaqAI TTAA 2 cut(s) 90, 138
SatI GCNGC 1 cut(s) 59
SchI GAGTC 1 cut(s) 62
ScrFI CCNGG 1 cut(s) 156
SetI ASST 5 cut(s) 40, 98, 111, 120, 149
SfaNI GCATC 1 cut(s) 15
SgeI CNNG 8 cut(s) 30, 41, 51, 60, 84, 97, 116, 125
SspMI CTAG 1 cut(s) 39
StyD4I CCNGG 1 cut(s) 154
Tru1I TTAA 2 cut(s) 90, 138
Tru9I TTAA 2 cut(s) 90, 138
TseI GCWGC 1 cut(s) 58
TspDTI ATGAA 2 cut(s) 101, 150
XspI CTAG 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.