RchiOBHm_Chr3g0476241

Belongs to the RNase T2 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0009701
Physical Location & Seq
Reverse (-)
22213823 .. 22215093
1271 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ44167

Sequence Viewer

Length: 636 bp
ATGAAAATTATTCCTTTTCTTGCCCTCCTATTTTTCCTATTCCCCTCAACTGTACGGGGCGAAATGAAATATTATGACGGTCAAATGCTTGTCTTACAAAATAGCAAAGTTGATTTATGGACGATTCATGGCCTTTGGACTTGCGAACTTACCGGAAAAGAACCTGATTTCTACTATAAGCAAGTTACCGATTGTTCACCATTTGAAAGATTTAATTTAAATGAGCTTAGTGGCAGGGAACGATCGATACTCACTAGGGTTTGGCTTAGTAACAATAAGAATACGAGGATTACCTATCAATTCTGGGAGTATGAATATGAAAAACACGGTTCATGTACCACAGATATATTACCAAGCTGTAGAGATTATTTAATGAAAGCAACTGTATTGTGGAATATACTCAAGTTTGACGATTTGCTGGGTCCTAACGGCAAGTATAAGCCAAACACTTCATTTCAAGCCCAAGACTTGCTGGATGACATGGAAGTGAAGTATGAGGTCCGACCACTGTTGAAGTGTAATCTTCAGGGGGAACTACCGGAAGTTTGGTTTTGTTATACAAAAGTATGGAAAAGCATATTTTGCGCGTCTACGACAGATTCTTGTATGGGGCATATTAAATATGTTAGGACATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ribonuclease_T2

Protein Analysis

211

Amino Acids

24.95

Weight (kDa)

6.81

Isoelectric Point (pI)

41.17

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribonuclease_T2 PF00445 34 - 189 1.3e-19 Ribonuclease T2 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 590
AccII CGCG 1 cut(s) 587
AcuI CTGAAG 1 cut(s) 509
AfaI GTAC 2 cut(s) 54, 337
AgsI TTSAA 3 cut(s) 206, 458, 514
AluBI AGCT 2 cut(s) 226, 357
AluI AGCT 2 cut(s) 226, 357
AoxI GGCC 1 cut(s) 130
AspLEI GCGC 1 cut(s) 587
AspS9I GGNCC 2 cut(s) 422, 499
AsuHPI GGTGA 1 cut(s) 189
AvaII GGWCC 2 cut(s) 422, 499
BceAI ACGGC 1 cut(s) 445
BfaI CTAG 1 cut(s) 255
BfmI CTRYAG 1 cut(s) 358
Bme18I GGWCC 2 cut(s) 422, 499
BmgT120I GGNCC 2 cut(s) 422, 499
BmiI GGNNCC 1 cut(s) 423
BpuEI CTTGAG 1 cut(s) 386
Bsa29I ATCGAT 1 cut(s) 245
BsaWI WCCGGW 2 cut(s) 152, 538
BseCI ATCGAT 1 cut(s) 245
BseGI GGATG 1 cut(s) 481
BseYI CCCAGC 1 cut(s) 418
Bsh1236I CGCG 1 cut(s) 587
Bsh1285I CGRYCG 1 cut(s) 245
BshFI GGCC 1 cut(s) 132
BshVI ATCGAT 1 cut(s) 245
BsiEI CGRYCG 1 cut(s) 245
BsiSI CCGG 2 cut(s) 153, 539
BsnI GGCC 1 cut(s) 132
Bsp143I GATC 1 cut(s) 242
BspANI GGCC 1 cut(s) 132
BspDI ATCGAT 1 cut(s) 245
BspFNI CGCG 1 cut(s) 587
BspLI GGNNCC 1 cut(s) 423
BssMI GATC 1 cut(s) 242
Bst4CI ACNGT 5 cut(s) 52, 80, 329, 385, 510
BstAPI GCANNNNNTGC 1 cut(s) 582
BstDEI CTNAG 2 cut(s) 227, 266
BstF5I GGATG 1 cut(s) 481
BstFNI CGCG 1 cut(s) 587
BstHHI GCGC 1 cut(s) 587
BstKTI GATC 1 cut(s) 245
BstMBI GATC 1 cut(s) 242
BstMCI CGRYCG 1 cut(s) 245
BstMWI GCNNNNNNNGC 1 cut(s) 582
BstSFI CTRYAG 1 cut(s) 358
BstUI CGCG 1 cut(s) 587
Bsu15I ATCGAT 1 cut(s) 245
BsuRI GGCC 1 cut(s) 132
BsuTUI ATCGAT 1 cut(s) 245
BtsCI GGATG 1 cut(s) 481
BtsIMutI CAGTG 1 cut(s) 506
CfoI GCGC 1 cut(s) 587
Cfr13I GGNCC 2 cut(s) 422, 499
ClaI ATCGAT 1 cut(s) 245
CseI GACGC 1 cut(s) 576
Csp6I GTAC 2 cut(s) 53, 336
CviAII CATG 3 cut(s) 128, 333, 481
CviJI RGCY 6 cut(s) 132, 226, 265, 357, 442, 461
CviKI_1 RGCY 6 cut(s) 132, 226, 265, 357, 442, 461
CviQI GTAC 2 cut(s) 53, 336
DdeI CTNAG 2 cut(s) 227, 266
DpnI GATC 1 cut(s) 244
DpnII GATC 1 cut(s) 242
DraI TTTAAA 1 cut(s) 219
Eco47I GGWCC 2 cut(s) 422, 499
Eco57I CTGAAG 1 cut(s) 509
EcoO109I RGGNCCY 1 cut(s) 422
FaeI CATG 3 cut(s) 131, 336, 484
FatI CATG 3 cut(s) 127, 332, 480
FblI GTMKAC 1 cut(s) 590
FokI GGATG 1 cut(s) 488
FspBI CTAG 1 cut(s) 255
GlaI GCGC 1 cut(s) 586
GsaI CCCAGC 1 cut(s) 422
HaeIII GGCC 1 cut(s) 132
HapII CCGG 2 cut(s) 153, 539
HgaI GACGC 1 cut(s) 576
HhaI GCGC 1 cut(s) 587
Hin1II CATG 3 cut(s) 131, 336, 484
Hin6I GCGC 1 cut(s) 585
HinP1I GCGC 1 cut(s) 585
HinfI GANTC 2 cut(s) 124, 599
HpaII CCGG 2 cut(s) 153, 539
HphI GGTGA 1 cut(s) 189
Hpy166II GTNNAC 2 cut(s) 197, 591
Hpy188I TCNGA 1 cut(s) 503
Hpy8I GTNNAC 2 cut(s) 197, 591
HpyCH4III ACNGT 5 cut(s) 52, 80, 329, 385, 510
HpyF10VI GCNNNNNNNGC 1 cut(s) 582
HpyF3I CTNAG 2 cut(s) 227, 266
Hsp92II CATG 3 cut(s) 131, 336, 484
HspAI GCGC 1 cut(s) 585
Kzo9I GATC 1 cut(s) 242
LpnPI CCDG 8 cut(s) 166, 177, 220, 289, 404, 458, 512, 552
MaeI CTAG 1 cut(s) 255
MaeIII GTNAC 2 cut(s) 184, 269
MalI GATC 1 cut(s) 244
MboI GATC 1 cut(s) 242
MboII GAAGA 1 cut(s) 515
MluCI AATT 3 cut(s) 6, 214, 299
MmeI TCCRAC 1 cut(s) 526
MnlI CCTC 4 cut(s) 35, 55, 279, 490
MseI TTAA 4 cut(s) 213, 218, 371, 618
MslI CAYNNNNRTG 1 cut(s) 485
MspI CCGG 2 cut(s) 153, 539
MvnI CGCG 1 cut(s) 587
MwoI GCNNNNNNNGC 1 cut(s) 582
NdeII GATC 1 cut(s) 242
NlaIII CATG 3 cut(s) 131, 336, 484
NlaIV GGNNCC 1 cut(s) 423
PfeI GAWTC 2 cut(s) 124, 599
Ple19I CGATCG 1 cut(s) 245
PpuMI RGGWCCY 1 cut(s) 422
Psp5II RGGWCCY 1 cut(s) 422
PspFI CCCAGC 1 cut(s) 418
PspN4I GGNNCC 1 cut(s) 423
PspPI GGNCC 2 cut(s) 422, 499
PspPPI RGGWCCY 1 cut(s) 422
PsrI GAACNNNNNNTAC 2 cut(s) 231, 263
PvuI CGATCG 1 cut(s) 245
RsaI GTAC 2 cut(s) 54, 337
RsaNI GTAC 2 cut(s) 53, 336
RseI CAYNNNNRTG 1 cut(s) 485
SaqAI TTAA 4 cut(s) 213, 218, 371, 618
Sau3AI GATC 1 cut(s) 242
Sau96I GGNCC 2 cut(s) 422, 499
SetI ASST 5 cut(s) 166, 228, 296, 359, 501
SfcI CTRYAG 1 cut(s) 358
SinI GGWCC 2 cut(s) 422, 499
SmiI ATTTAAAT 1 cut(s) 219
SmiMI CAYNNNNRTG 1 cut(s) 485
SmlI CTYRAG 1 cut(s) 401
SmoI CTYRAG 1 cut(s) 401
Sse9I AATT 3 cut(s) 6, 214, 299
SspI AATATT 1 cut(s) 71
SspMI CTAG 1 cut(s) 255
SwaI ATTTAAAT 1 cut(s) 219
TaaI ACNGT 5 cut(s) 52, 80, 329, 385, 510
TaqI TCGA 1 cut(s) 245
TasI AATT 3 cut(s) 6, 214, 299
TfiI GAWTC 2 cut(s) 124, 599
Tru1I TTAA 4 cut(s) 213, 218, 371, 618
Tru9I TTAA 4 cut(s) 213, 218, 371, 618
TscAI CASTG 1 cut(s) 513
TspDTI ATGAA 8 cut(s) 17, 80, 116, 321, 327, 333, 389, 441
TspRI CASTG 1 cut(s) 513
VpaK11BI GGWCC 2 cut(s) 422, 499
XmiI GTMKAC 1 cut(s) 590
XspI CTAG 1 cut(s) 255
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.