Rh3DG240700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Reverse (-)
23145333 .. 23145626
294 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG240700.1

Sequence Viewer

Length: 240 bp
ATGGAAATCATTTATTTTCTTGCTTTCATATTATTTTTATCCCCCGCAACTGTGCCAGCACAGACAAACAAAGGTTACGACTATATCACGCTGGTCATCCAAAATCCTTATAGCATGAATAGCTCTACTCCTTGGACCATACATGGCCTGTGGGCCCAGAAACTTCAAGGACAATCTCCTAACTATACATTTGTGCCAGTTAATAGATGTCCATCAGCCCCTCCATTTAACAATCTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

8.94

Weight (kDa)

7.89

Isoelectric Point (pI)

62.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 45
AgsI TTSAA 1 cut(s) 167
AluBI AGCT 1 cut(s) 123
AluI AGCT 1 cut(s) 123
AoxI GGCC 2 cut(s) 145, 153
ApaI GGGCCC 1 cut(s) 157
AspS9I GGNCC 3 cut(s) 135, 153, 154
AvaII GGWCC 1 cut(s) 135
BaeGI GKGCMC 1 cut(s) 157
BanII GRGCYC 1 cut(s) 157
BccI CCATC 1 cut(s) 220
Bme18I GGWCC 1 cut(s) 135
BmgT120I GGNCC 3 cut(s) 135, 153, 154
BmiI GGNNCC 1 cut(s) 155
BsaBI GATNNNNATC 1 cut(s) 211
BsaJI CCNNGG 1 cut(s) 131
Bse1I ACTGG 1 cut(s) 197
Bse8I GATNNNNATC 1 cut(s) 211
BseDI CCNNGG 1 cut(s) 131
BseGI GGATG 1 cut(s) 96
BseJI GATNNNNATC 1 cut(s) 211
BseNI ACTGG 1 cut(s) 197
BseSI GKGCMC 1 cut(s) 157
BshFI GGCC 2 cut(s) 147, 155
BsnI GGCC 2 cut(s) 147, 155
Bsp120I GGGCCC 1 cut(s) 153
Bsp1286I GDGCHC 1 cut(s) 157
BspACI CCGC 1 cut(s) 45
BspANI GGCC 2 cut(s) 147, 155
BspLI GGNNCC 1 cut(s) 155
BsrI ACTGG 1 cut(s) 197
BssECI CCNNGG 1 cut(s) 131
BssT1I CCWWGG 1 cut(s) 131
Bst4CI ACNGT 1 cut(s) 52
BstC8I GCNNGC 1 cut(s) 57
BstF5I GGATG 1 cut(s) 96
BstMWI GCNNNNNNNGC 1 cut(s) 120
BstSLI GKGCMC 1 cut(s) 157
BsuRI GGCC 2 cut(s) 147, 155
BtsCI GGATG 1 cut(s) 96
Cac8I GCNNGC 1 cut(s) 57
Cfr13I GGNCC 3 cut(s) 135, 153, 154
CviAII CATG 2 cut(s) 115, 143
CviJI RGCY 4 cut(s) 123, 147, 155, 218
CviKI_1 RGCY 4 cut(s) 123, 147, 155, 218
Eco130I CCWWGG 1 cut(s) 131
Eco24I GRGCYC 1 cut(s) 157
Eco47I GGWCC 1 cut(s) 135
EcoT14I CCWWGG 1 cut(s) 131
EcoT38I GRGCYC 1 cut(s) 157
ErhI CCWWGG 1 cut(s) 131
FaeI CATG 2 cut(s) 118, 146
FaiI YATR 7 cut(s) 29, 84, 111, 116, 140, 144, 186
FatI CATG 2 cut(s) 114, 142
FauI CCCGC 1 cut(s) 52
FokI GGATG 1 cut(s) 83
FriOI GRGCYC 1 cut(s) 157
HaeIII GGCC 2 cut(s) 147, 155
Hin1II CATG 2 cut(s) 118, 146
HpyCH4III ACNGT 1 cut(s) 52
HpyF10VI GCNNNNNNNGC 1 cut(s) 120
Hsp92II CATG 2 cut(s) 118, 146
LpnPI CCDG 5 cut(s) 69, 77, 161, 170, 210
MaeIII GTNAC 1 cut(s) 74
MhlI GDGCHC 1 cut(s) 157
MnlI CCTC 1 cut(s) 231
MseI TTAA 2 cut(s) 201, 228
MwoI GCNNNNNNNGC 1 cut(s) 120
NlaIII CATG 2 cut(s) 118, 146
NlaIV GGNNCC 1 cut(s) 155
PspN4I GGNNCC 1 cut(s) 155
PspOMI GGGCCC 1 cut(s) 153
PspPI GGNCC 3 cut(s) 135, 153, 154
SaqAI TTAA 2 cut(s) 201, 228
Sau96I GGNCC 3 cut(s) 135, 153, 154
SduI GDGCHC 1 cut(s) 157
SetI ASST 2 cut(s) 76, 125
SinI GGWCC 1 cut(s) 135
SsiI CCGC 1 cut(s) 45
StyI CCWWGG 1 cut(s) 131
TaaI ACNGT 1 cut(s) 52
Tru1I TTAA 2 cut(s) 201, 228
Tru9I TTAA 2 cut(s) 201, 228
TspDTI ATGAA 2 cut(s) 16, 131
VpaK11BI GGWCC 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.