Rh3CG241400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
OG0009701
Physical Location & Seq
Reverse (-)
23120624 .. 23121031
408 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG241400.1

Sequence Viewer

Length: 258 bp
ATGTTCTCAACCAGCGCTAGTCCTTGGACGACAAATGGCATCTGGGCAGTCAACCTTGCGGGGGAATCTCCTCCAGAGTATAAGTATGTGGAACTTGATAACTGTCCATCAGCCCCTCCATTTGACCATCAGCTTACTGACGGTGTTATAAGTGCAATCTCTAAAGCTTGGCCCAATCCTTTTTGGAATATCACGACAGCCATGGAAATTTGGAGACGTGAATATGAGATATACGGTTCATGTACCATAGATATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

85

Amino Acids

9.6

Weight (kDa)

4.31

Isoelectric Point (pI)

55.55

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribonuclease_T2 PF00445 6 - 82 1.1e-06 Ribonuclease T2 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 149
AciI CCGC 1 cut(s) 59
AcsI RAATTY 1 cut(s) 207
AfaI GTAC 1 cut(s) 244
AfeI AGCGCT 1 cut(s) 16
AfiI CCNNNNNNNGG 1 cut(s) 61
AjiI CACGTC 1 cut(s) 218
AluBI AGCT 2 cut(s) 133, 167
AluI AGCT 2 cut(s) 133, 167
Alw26I GTCTC 1 cut(s) 208
Aor51HI AGCGCT 1 cut(s) 16
AoxI GGCC 1 cut(s) 170
ApoI RAATTY 1 cut(s) 207
AspLEI GCGC 1 cut(s) 17
AspS9I GGNCC 1 cut(s) 171
BccI CCATC 2 cut(s) 115, 135
BcoDI GTCTC 1 cut(s) 208
BfaI CTAG 1 cut(s) 18
BfoI RGCGCY 1 cut(s) 18
BmgBI CACGTC 1 cut(s) 218
BmgT120I GGNCC 1 cut(s) 171
BmsI GCATC 1 cut(s) 48
BpmI CTGGAG 1 cut(s) 57
BsaJI CCNNGG 2 cut(s) 23, 201
Bsc4I CCNNNNNNNGG 1 cut(s) 61
BseDI CCNNGG 2 cut(s) 23, 201
BseLI CCNNNNNNNGG 1 cut(s) 61
BseRI GAGGAG 1 cut(s) 60
BshFI GGCC 1 cut(s) 172
BslI CCNNNNNNNGG 1 cut(s) 61
BsmAI GTCTC 1 cut(s) 208
BsmBI CGTCTC 1 cut(s) 208
BsnI GGCC 1 cut(s) 172
Bsp19I CCATGG 1 cut(s) 201
BspACI CCGC 1 cut(s) 59
BspANI GGCC 1 cut(s) 172
BssECI CCNNGG 2 cut(s) 23, 201
BssT1I CCWWGG 2 cut(s) 23, 201
Bst4CI ACNGT 3 cut(s) 104, 143, 236
BstDSI CCRYGG 1 cut(s) 201
BstH2I RGCGCY 1 cut(s) 18
BstHHI GCGC 1 cut(s) 17
BstMAI GTCTC 1 cut(s) 208
BsuRI GGCC 1 cut(s) 172
BtgI CCRYGG 1 cut(s) 201
BtrI CACGTC 1 cut(s) 218
CfoI GCGC 1 cut(s) 17
Cfr13I GGNCC 1 cut(s) 171
Csp6I GTAC 1 cut(s) 243
CviAII CATG 2 cut(s) 202, 240
CviJI RGCY 5 cut(s) 113, 133, 167, 172, 200
CviKI_1 RGCY 5 cut(s) 113, 133, 167, 172, 200
CviQI GTAC 1 cut(s) 243
Eco130I CCWWGG 2 cut(s) 23, 201
Eco47III AGCGCT 1 cut(s) 16
EcoT14I CCWWGG 2 cut(s) 23, 201
ErhI CCWWGG 2 cut(s) 23, 201
Esp3I CGTCTC 1 cut(s) 208
FaeI CATG 2 cut(s) 205, 243
FatI CATG 2 cut(s) 201, 239
FauI CCCGC 1 cut(s) 52
FspBI CTAG 1 cut(s) 18
GlaI GCGC 1 cut(s) 16
GsuI CTGGAG 1 cut(s) 57
HaeII RGCGCY 1 cut(s) 18
HaeIII GGCC 1 cut(s) 172
HhaI GCGC 1 cut(s) 17
Hin1II CATG 2 cut(s) 205, 243
Hin6I GCGC 1 cut(s) 15
HinP1I GCGC 1 cut(s) 15
HincII GTYRAC 1 cut(s) 52
HindII GTYRAC 1 cut(s) 52
HindIII AAGCTT 1 cut(s) 165
HinfI GANTC 1 cut(s) 65
Hpy166II GTNNAC 1 cut(s) 52
Hpy188III TCNNGA 2 cut(s) 74, 193
Hpy8I GTNNAC 1 cut(s) 52
HpyCH4III ACNGT 3 cut(s) 104, 143, 236
HpyCH4IV ACGT 1 cut(s) 217
HpyCH4V TGCA 1 cut(s) 155
HpySE526I ACGT 1 cut(s) 217
Hsp92II CATG 2 cut(s) 205, 243
HspAI GCGC 1 cut(s) 15
LpnPI CCDG 3 cut(s) 25, 28, 87
LweI GCATC 1 cut(s) 48
MaeI CTAG 1 cut(s) 18
MaeII ACGT 1 cut(s) 217
MluCI AATT 1 cut(s) 207
MnlI CCTC 2 cut(s) 81, 126
NcoI CCATGG 1 cut(s) 201
NlaIII CATG 2 cut(s) 205, 243
PfeI GAWTC 1 cut(s) 65
PsiI TTATAA 1 cut(s) 149
PspPI GGNCC 1 cut(s) 171
RsaI GTAC 1 cut(s) 244
RsaNI GTAC 1 cut(s) 243
Sau96I GGNCC 1 cut(s) 171
SetI ASST 4 cut(s) 57, 135, 169, 220
SfaNI GCATC 1 cut(s) 48
Sse9I AATT 1 cut(s) 207
SsiI CCGC 1 cut(s) 59
SspMI CTAG 1 cut(s) 18
StyI CCWWGG 2 cut(s) 23, 201
TaaI ACNGT 3 cut(s) 104, 143, 236
TaiI ACGT 1 cut(s) 220
TasI AATT 1 cut(s) 207
TfiI GAWTC 1 cut(s) 65
TspDTI ATGAA 1 cut(s) 228
XapI RAATTY 1 cut(s) 207
XspI CTAG 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.