Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0017867.1

Orthogroup ID

OG0009701

Physical Location & Seq

Genomic Coordinates Forward (+)

11681 .. 12370

Gene Structure 690 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0017867.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 540 bp

atgttctcaaccagcgctagtccttggacgacaaatggcatctgggcagtcaaccttgcgggggaatctcctccagagtataagtatgtggtacttgataactgtccatcagcccctccatttgaccatcagcttactgacggtgttataagtgcaatctctaaagcttggccaaatcctttttggaatatcacgacagccagggaaatttggagacatgaatatgagatatacggttcatgtaccatagatatgttaccaacttccactagttatttactgcaagcactttacttgtgggagaaactcaagtttcacgatttgatgggtgagaatggcaattataagccaaatactcaatatcaaactgaggacgtgctgaacggcatcaaacgtttctattatgtccaaccaatattgatatgttctggtagtgaattagaggatgttaggttttgtcatacaggacattgggtgctgataaattgcatggacacccaatcaacttgtactggtcttattcaatatagtcggagctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004518 GO:0004519 GO:0004521 GO:0004540 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005783 GO:0006139 GO:0006401 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009056 GO:0009057 GO:0009892 GO:0009894 GO:0009895 GO:0009987 GO:0010168 GO:0010506 GO:0010507 GO:0012505 GO:0016070 GO:0016072 GO:0016075 GO:0016787 GO:0016788 GO:0019222 GO:0019439 GO:0031323 GO:0031324 GO:0031329 GO:0031330 GO:0034641 GO:0034655 GO:0034660 GO:0034661 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044237 GO:0044238 GO:0044248 GO:0044260 GO:0044265 GO:0044270 GO:0044424 GO:0044444 GO:0044464 GO:0046483 GO:0046700 GO:0048519 GO:0048523 GO:0050789 GO:0050794 GO:0065007 GO:0071704 GO:0090304 GO:0090305 GO:0090501 GO:0090502 GO:0140098 GO:1901360 GO:1901361 GO:1901575

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Ribonuclease_T2

Protein Analysis

179

Amino Acids

20.51

Weight (kDa)

5.09

Isoelectric Point (pI)

45.9

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009701)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g22290 FvH4_6g22334 FvH4_6g22981
rosa_chinensis	RchiOBHm_Chr3g0476241 RchiOBHm_Chr3g0477761 RchiOBHm_Chr3g0477801 RchiOBHm_Chr3g0479851
rosa_laevigata	RLG00000023532
rosa_multiflora	Rmu_sc0017867.1_g000005
rosa_samantha	Rh3AG213600 Rh3AG213700 Rh3AG213900 Rh3AG229700 Rh3AG229800 Rh3BG247500 Rh3CG241400 Rh3CG259700 Rh3DG240600 Rh3DG240700 Rh3DG240800 Rh3DG255900
rosa_wichuraiana	Rw3G020680

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	2 cut(s)	149, 345
AciI	CCGC	1 cut(s)	59
AclI	AACGTT	1 cut(s)	394
AcoI	YGGCCR	1 cut(s)	170
AcsI	RAATTY	1 cut(s)	207
AfaI	GTAC	3 cut(s)	93, 244, 511
AfeI	AGCGCT	1 cut(s)	16
AfiI	CCNNNNNNNGG	1 cut(s)	61
AgsI	TTSAA	1 cut(s)	524
AhlI	ACTAGT	1 cut(s)	269
AjiI	CACGTC	1 cut(s)	376
AjnI	CCWGG	1 cut(s)	200
AluBI	AGCT	3 cut(s)	133, 167, 537
AluI	AGCT	3 cut(s)	133, 167, 537
Alw26I	GTCTC	1 cut(s)	208
Aor51HI	AGCGCT	1 cut(s)	16
AoxI	GGCC	1 cut(s)	170
ApoI	RAATTY	1 cut(s)	207
AspLEI	GCGC	1 cut(s)	17
AsuHPI	GGTGA	1 cut(s)	341
BalI	TGGCCA	1 cut(s)	172
BccI	CCATC	3 cut(s)	115, 135, 319
BceAI	ACGGC	1 cut(s)	400
BciT130I	CCWGG	1 cut(s)	202
BcoDI	GTCTC	1 cut(s)	208
BcuI	ACTAGT	1 cut(s)	269
BfaI	CTAG	3 cut(s)	18, 270, 538
BfoI	RGCGCY	1 cut(s)	18
Bme1390I	CCNGG	1 cut(s)	202
BmgBI	CACGTC	1 cut(s)	376
BmrFI	CCNGG	1 cut(s)	202
BmsI	GCATC	2 cut(s)	48, 396
BpmI	CTGGAG	1 cut(s)	57
BpuEI	CTTGAG	1 cut(s)	293
BsaJI	CCNNGG	2 cut(s)	23, 201
Bsc4I	CCNNNNNNNGG	1 cut(s)	61
Bse1I	ACTGG	1 cut(s)	517
BseBI	CCWGG	1 cut(s)	202
BseDI	CCNNGG	2 cut(s)	23, 201
BseGI	GGATG	1 cut(s)	451
BseLI	CCNNNNNNNGG	1 cut(s)	61
BseMII	CTCAG	1 cut(s)	360
BseNI	ACTGG	1 cut(s)	517
BseRI	GAGGAG	1 cut(s)	60
BshFI	GGCC	1 cut(s)	172
BslI	CCNNNNNNNGG	1 cut(s)	61
BsmAI	GTCTC	1 cut(s)	208
BsnI	GGCC	1 cut(s)	172
BspACI	CCGC	1 cut(s)	59
BspANI	GGCC	1 cut(s)	172
BspCNI	CTCAG	1 cut(s)	361
BsrI	ACTGG	1 cut(s)	517
BssECI	CCNNGG	2 cut(s)	23, 201
BssT1I	CCWWGG	1 cut(s)	23
Bst2UI	CCWGG	1 cut(s)	202
Bst4CI	ACNGT	3 cut(s)	104, 143, 236
BstC8I	GCNNGC	1 cut(s)	285
BstDEI	CTNAG	1 cut(s)	369
BstF5I	GGATG	1 cut(s)	451
BstH2I	RGCGCY	1 cut(s)	18
BstHHI	GCGC	1 cut(s)	17
BstMAI	GTCTC	1 cut(s)	208
BstNI	CCWGG	1 cut(s)	202
BstSCI	CCNGG	1 cut(s)	200
BsuRI	GGCC	1 cut(s)	172
BtrI	CACGTC	1 cut(s)	376
BtsCI	GGATG	1 cut(s)	451
Cac8I	GCNNGC	1 cut(s)	285
CfoI	GCGC	1 cut(s)	17
Csp6I	GTAC	3 cut(s)	92, 243, 510
CviAII	CATG	3 cut(s)	218, 240, 490
CviJI	RGCY	7 cut(s)	113, 133, 167, 172, 200, 349, 537
CviKI_1	RGCY	7 cut(s)	113, 133, 167, 172, 200, 349, 537
CviQI	GTAC	3 cut(s)	92, 243, 510
DdeI	CTNAG	1 cut(s)	369
EaeI	YGGCCR	1 cut(s)	170
Eco130I	CCWWGG	1 cut(s)	23
Eco47III	AGCGCT	1 cut(s)	16
EcoRII	CCWGG	1 cut(s)	200
EcoT14I	CCWWGG	1 cut(s)	23
ErhI	CCWWGG	1 cut(s)	23
FaeI	CATG	3 cut(s)	221, 243, 493
FatI	CATG	3 cut(s)	217, 239, 489
FauI	CCCGC	1 cut(s)	52
FokI	GGATG	1 cut(s)	458
FspBI	CTAG	3 cut(s)	18, 270, 538
GlaI	GCGC	1 cut(s)	16
GsuI	CTGGAG	1 cut(s)	57
HaeII	RGCGCY	1 cut(s)	18
HaeIII	GGCC	1 cut(s)	172
HhaI	GCGC	1 cut(s)	17
Hin1II	CATG	3 cut(s)	221, 243, 493
Hin6I	GCGC	1 cut(s)	15
HinP1I	GCGC	1 cut(s)	15
HincII	GTYRAC	1 cut(s)	52
HindII	GTYRAC	1 cut(s)	52
HindIII	AAGCTT	1 cut(s)	165
HinfI	GANTC	1 cut(s)	65
HphI	GGTGA	1 cut(s)	341
Hpy166II	GTNNAC	1 cut(s)	52
Hpy188I	TCNGA	1 cut(s)	534
Hpy188III	TCNNGA	3 cut(s)	74, 193, 317
Hpy8I	GTNNAC	1 cut(s)	52
HpyCH4III	ACNGT	3 cut(s)	104, 143, 236
HpyCH4IV	ACGT	2 cut(s)	375, 394
HpyCH4V	TGCA	3 cut(s)	155, 283, 489
HpyF3I	CTNAG	1 cut(s)	369
HpySE526I	ACGT	2 cut(s)	375, 394
Hsp92II	CATG	3 cut(s)	221, 243, 493
HspAI	GCGC	1 cut(s)	15
LmnI	GCTCC	1 cut(s)	534
LpnPI	CCDG	8 cut(s)	25, 28, 87, 187, 214, 414, 450, 498
LweI	GCATC	2 cut(s)	48, 396
MaeI	CTAG	3 cut(s)	18, 270, 538
MaeII	ACGT	2 cut(s)	375, 394
MaeIII	GTNAC	1 cut(s)	255
MlsI	TGGCCA	1 cut(s)	172
MluCI	AATT	4 cut(s)	207, 340, 437, 484
MluNI	TGGCCA	1 cut(s)	172
MmeI	TCCRAC	2 cut(s)	433, 512
MnlI	CCTC	4 cut(s)	81, 126, 364, 436
Mox20I	TGGCCA	1 cut(s)	172
MscI	TGGCCA	1 cut(s)	172
MslI	CAYNNNNRTG	2 cut(s)	222, 251
Msp20I	TGGCCA	1 cut(s)	172
MspR9I	CCNGG	1 cut(s)	202
MvaI	CCWGG	1 cut(s)	202
NlaIII	CATG	3 cut(s)	221, 243, 493
PfeI	GAWTC	1 cut(s)	65
PsiI	TTATAA	2 cut(s)	149, 345
Psp1406I	AACGTT	1 cut(s)	394
Psp6I	CCWGG	1 cut(s)	200
PspGI	CCWGG	1 cut(s)	200
RsaI	GTAC	3 cut(s)	93, 244, 511
RsaNI	GTAC	3 cut(s)	92, 243, 510
RseI	CAYNNNNRTG	2 cut(s)	222, 251
ScrFI	CCNGG	1 cut(s)	202
SetI	ASST	7 cut(s)	57, 135, 169, 378, 397, 455, 539
SfaNI	GCATC	2 cut(s)	48, 396
SmiMI	CAYNNNNRTG	2 cut(s)	222, 251
SmlI	CTYRAG	1 cut(s)	308
SmoI	CTYRAG	1 cut(s)	308
SpeI	ACTAGT	1 cut(s)	269
Sse9I	AATT	4 cut(s)	207, 340, 437, 484
SsiI	CCGC	1 cut(s)	59
SspI	AATATT	1 cut(s)	417
SspMI	CTAG	3 cut(s)	18, 270, 538
StyD4I	CCNGG	1 cut(s)	200
StyI	CCWWGG	1 cut(s)	23
TaaI	ACNGT	3 cut(s)	104, 143, 236
TaiI	ACGT	2 cut(s)	378, 397
TasI	AATT	4 cut(s)	207, 340, 437, 484
TatI	WGTACW	1 cut(s)	509
TfiI	GAWTC	1 cut(s)	65
TspDTI	ATGAA	2 cut(s)	228, 234
XapI	RAATTY	1 cut(s)	207
XcmI	CCANNNNNNNNNTGG	1 cut(s)	180
XspI	CTAG	3 cut(s)	18, 270, 538

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.