Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr3A

Orthogroup ID

OG0009701

Physical Location & Seq

Genomic Coordinates Forward (+)

23671486 .. 23695099

Gene Structure 23614 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh3AG229700.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 540 bp

ATGGCATTGTCTAGGAAAAGCCAAAAGGATTTCAAGGAAATTGAGACTTTGCTAGATTCAAAGATCGTCGTCTTGTTCTTTGCCAACAATCATCATCATCTCCACTTCTCTAGATTCCAAAATCCCAAATTCTCCCATCTCAAATCTAACAGATTTGAGAATTGGCAAGAGCCAAGAAGGATTTTTGAGTCTAACACAACAATTTCGTTGGTCGATCCTTATCTGTTATTGGATGAGCAAAACCATATGCTGCTGCTGAAACAATCCAAGCCTGAGGGAAAAGAGGAGAGTGAAGAGCTGAAAAGCCTGGGCCTATTATATCGAAAGATCGAGGCTGATCTGGGCAAAAGGAGAAAGAGTCCAGATCTGATCATGTTCTGTGTGCAATTTCAAAGATTTAAGAGTGATCTGGAGTGGGCGCTACACTGCTACTGGGTCTCGGTTGGGTTGACTGCTCCTTTCCCAGGGCATTTTGGAGTCTTGTTAGAACTCCAAACCTTATATCTGGACTTTTTGAAACCCAGAAGAAGCATAAAGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

179

Amino Acids

21.25

Weight (kDa)

9.2

Isoelectric Point (pI)

39.09

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009701)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g22290 FvH4_6g22334 FvH4_6g22981
rosa_chinensis	RchiOBHm_Chr3g0476241 RchiOBHm_Chr3g0477761 RchiOBHm_Chr3g0477801 RchiOBHm_Chr3g0479851
rosa_laevigata	RLG00000023532
rosa_multiflora	Rmu_sc0017867.1_g000005
rosa_samantha	Rh3AG213600 Rh3AG213700 Rh3AG213900 Rh3AG229700 Rh3AG229800 Rh3BG247500 Rh3CG241400 Rh3CG259700 Rh3DG240600 Rh3DG240700 Rh3DG240800 Rh3DG255900
rosa_wichuraiana	Rw3G020680

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	209
AcsI	RAATTY	1 cut(s)	128
AfiI	CCNNNNNNNGG	1 cut(s)	464
AgsI	TTSAA	4 cut(s)	34, 60, 392, 517
AjnI	CCWGG	2 cut(s)	306, 463
AluBI	AGCT	1 cut(s)	298
AluI	AGCT	1 cut(s)	298
Alw26I	GTCTC	2 cut(s)	38, 442
AlwI	GGATC	1 cut(s)	209
AoxI	GGCC	1 cut(s)	310
ApeKI	GCWGC	2 cut(s)	250, 253
ApoI	RAATTY	1 cut(s)	128
AspLEI	GCGC	1 cut(s)	421
AspS9I	GGNCC	1 cut(s)	310
AxyI	CCTNAGG	1 cut(s)	273
BbvI	GCAGC	2 cut(s)	237, 240
BccI	CCATC	1 cut(s)	144
BciT130I	CCWGG	2 cut(s)	308, 465
BclI	TGATCA	1 cut(s)	369
BcoDI	GTCTC	2 cut(s)	38, 442
BfaI	CTAG	3 cut(s)	12, 53, 111
BfoI	RGCGCY	1 cut(s)	422
BglII	AGATCT	1 cut(s)	364
BisI	GCNGC	2 cut(s)	251, 254
BlsI	GCNGC	2 cut(s)	252, 255
Bme1390I	CCNGG	2 cut(s)	308, 465
BmgT120I	GGNCC	1 cut(s)	310
BmrFI	CCNGG	2 cut(s)	308, 465
BmrI	ACTGGG	1 cut(s)	442
BmuI	ACTGGG	1 cut(s)	442
BpmI	CTGGAG	1 cut(s)	431
BsaBI	GATNNNNATC	1 cut(s)	219
BsaI	GGTCTC	1 cut(s)	442
BsaJI	CCNNGG	3 cut(s)	307, 463, 464
BsaXI	ACNNNNNCTCC	2 cut(s)	343, 373
Bsc4I	CCNNNNNNNGG	1 cut(s)	464
Bse1I	ACTGG	1 cut(s)	437
Bse21I	CCTNAGG	1 cut(s)	273
Bse8I	GATNNNNATC	1 cut(s)	219
BseBI	CCWGG	2 cut(s)	308, 465
BseDI	CCNNGG	3 cut(s)	307, 463, 464
BseGI	GGATG	1 cut(s)	238
BseJI	GATNNNNATC	1 cut(s)	219
BseLI	CCNNNNNNNGG	1 cut(s)	464
BseMII	CTCAG	1 cut(s)	264
BseNI	ACTGG	1 cut(s)	437
BseRI	GAGGAG	1 cut(s)	299
BseXI	GCAGC	2 cut(s)	237, 240
BshFI	GGCC	1 cut(s)	312
BslI	CCNNNNNNNGG	1 cut(s)	464
BsmAI	GTCTC	2 cut(s)	38, 442
BsnI	GGCC	1 cut(s)	312
Bso31I	GGTCTC	1 cut(s)	442
Bsp143I	GATC	7 cut(s)	63, 214, 327, 337, 364, 369, 406
BspANI	GGCC	1 cut(s)	312
BspCNI	CTCAG	1 cut(s)	265
BspPI	GGATC	1 cut(s)	209
BspQI	GCTCTTC	1 cut(s)	288
BspTNI	GGTCTC	1 cut(s)	442
BsrI	ACTGG	1 cut(s)	437
BssECI	CCNNGG	3 cut(s)	307, 463, 464
BssMI	GATC	7 cut(s)	63, 214, 327, 337, 364, 369, 406
Bst2UI	CCWGG	2 cut(s)	308, 465
Bst6I	CTCTTC	1 cut(s)	288
BstDEI	CTNAG	1 cut(s)	273
BstENI	CCTNNNNNAGG	1 cut(s)	462
BstF5I	GGATG	1 cut(s)	238
BstH2I	RGCGCY	1 cut(s)	422
BstHHI	GCGC	1 cut(s)	421
BstKTI	GATC	7 cut(s)	66, 217, 330, 340, 367, 372, 409
BstMAI	GTCTC	2 cut(s)	38, 442
BstMBI	GATC	7 cut(s)	63, 214, 327, 337, 364, 369, 406
BstNI	CCWGG	2 cut(s)	308, 465
BstSCI	CCNGG	2 cut(s)	306, 463
BstV1I	GCAGC	2 cut(s)	237, 240
BstX2I	RGATCY	1 cut(s)	364
BstYI	RGATCY	1 cut(s)	364
Bsu36I	CCTNAGG	1 cut(s)	273
BsuRI	GGCC	1 cut(s)	312
BtsCI	GGATG	1 cut(s)	238
BtsI	GCAGTG	1 cut(s)	424
BtsIMutI	CAGTG	1 cut(s)	424
CfoI	GCGC	1 cut(s)	421
Cfr13I	GGNCC	1 cut(s)	310
CviAII	CATG	1 cut(s)	373
CviJI	RGCY	7 cut(s)	21, 172, 271, 298, 306, 312, 335
CviKI_1	RGCY	7 cut(s)	21, 172, 271, 298, 306, 312, 335
DdeI	CTNAG	1 cut(s)	273
DpnI	GATC	7 cut(s)	65, 216, 329, 339, 366, 371, 408
DpnII	GATC	7 cut(s)	63, 214, 327, 337, 364, 369, 406
Eam1104I	CTCTTC	1 cut(s)	288
EarI	CTCTTC	1 cut(s)	288
Eco31I	GGTCTC	1 cut(s)	442
Eco81I	CCTNAGG	1 cut(s)	273
EcoNI	CCTNNNNNAGG	1 cut(s)	462
EcoRII	CCWGG	2 cut(s)	306, 463
FaeI	CATG	1 cut(s)	376
FaiI	YATR	6 cut(s)	246, 248, 319, 374, 502, 533
FatI	CATG	1 cut(s)	372
FauNDI	CATATG	1 cut(s)	246
FbaI	TGATCA	1 cut(s)	369
Fnu4HI	GCNGC	2 cut(s)	251, 254
FokI	GGATG	1 cut(s)	245
Fsp4HI	GCNGC	2 cut(s)	251, 254
FspBI	CTAG	3 cut(s)	12, 53, 111
GlaI	GCGC	1 cut(s)	420
GluI	GCNGC	2 cut(s)	251, 254
GsuI	CTGGAG	1 cut(s)	431
HaeII	RGCGCY	1 cut(s)	422
HaeIII	GGCC	1 cut(s)	312
HhaI	GCGC	1 cut(s)	421
Hin1II	CATG	1 cut(s)	376
Hin6I	GCGC	1 cut(s)	419
HinP1I	GCGC	1 cut(s)	419
HincII	GTYRAC	1 cut(s)	450
HindII	GTYRAC	1 cut(s)	450
HinfI	GANTC	5 cut(s)	56, 114, 188, 358, 477
Hpy166II	GTNNAC	1 cut(s)	450
Hpy188I	TCNGA	1 cut(s)	369
Hpy188III	TCNNGA	4 cut(s)	111, 362, 410, 506
Hpy8I	GTNNAC	1 cut(s)	450
Hpy99I	CGWCG	1 cut(s)	71
HpyAV	CCTTC	1 cut(s)	171
HpyCH4V	TGCA	1 cut(s)	385
HpyF3I	CTNAG	1 cut(s)	273
Hsp92II	CATG	1 cut(s)	376
HspAI	GCGC	1 cut(s)	419
Ksp22I	TGATCA	1 cut(s)	369
Kzo9I	GATC	7 cut(s)	63, 214, 327, 337, 364, 369, 406
LguI	GCTCTTC	1 cut(s)	288
LmnI	GCTCC	1 cut(s)	460
Lsp1109I	GCAGC	2 cut(s)	237, 240
MaeI	CTAG	3 cut(s)	12, 53, 111
MalI	GATC	7 cut(s)	65, 216, 329, 339, 366, 371, 408
MboI	GATC	7 cut(s)	63, 214, 327, 337, 364, 369, 406
MboII	GAAGA	2 cut(s)	305, 537
MflI	RGATCY	1 cut(s)	364
MluCI	AATT	5 cut(s)	39, 128, 160, 201, 386
MlyI	GAGTC	3 cut(s)	197, 367, 486
MnlI	CCTC	3 cut(s)	268, 277, 325
MseI	TTAA	1 cut(s)	399
MspR9I	CCNGG	2 cut(s)	308, 465
MvaI	CCWGG	2 cut(s)	308, 465
NdeI	CATATG	1 cut(s)	246
NdeII	GATC	7 cut(s)	63, 214, 327, 337, 364, 369, 406
NlaIII	CATG	1 cut(s)	376
PasI	CCCWGGG	1 cut(s)	464
PciSI	GCTCTTC	1 cut(s)	288
PfeI	GAWTC	2 cut(s)	56, 114
PkrI	GCNGC	2 cut(s)	252, 255
PleI	GAGTC	3 cut(s)	196, 366, 485
PpsI	GAGTC	3 cut(s)	196, 366, 485
Psp6I	CCWGG	2 cut(s)	306, 463
PspGI	CCWGG	2 cut(s)	306, 463
PspPI	GGNCC	1 cut(s)	310
PsuI	RGATCY	1 cut(s)	364
SapI	GCTCTTC	1 cut(s)	288
SaqAI	TTAA	1 cut(s)	399
SatI	GCNGC	2 cut(s)	251, 254
Sau3AI	GATC	7 cut(s)	63, 214, 327, 337, 364, 369, 406
Sau96I	GGNCC	1 cut(s)	310
SchI	GAGTC	3 cut(s)	197, 367, 486
ScrFI	CCNGG	2 cut(s)	308, 465
SetI	ASST	2 cut(s)	300, 500
Sse9I	AATT	5 cut(s)	39, 128, 160, 201, 386
SspMI	CTAG	3 cut(s)	12, 53, 111
StyD4I	CCNGG	2 cut(s)	306, 463
TaqI	TCGA	3 cut(s)	213, 322, 330
TasI	AATT	5 cut(s)	39, 128, 160, 201, 386
TfiI	GAWTC	2 cut(s)	56, 114
Tru1I	TTAA	1 cut(s)	399
Tru9I	TTAA	1 cut(s)	399
TscAI	CASTG	1 cut(s)	431
TseI	GCWGC	2 cut(s)	250, 253
TspRI	CASTG	1 cut(s)	431
XagI	CCTNNNNNAGG	1 cut(s)	462
XapI	RAATTY	1 cut(s)	128
XbaI	TCTAGA	1 cut(s)	110
XspI	CTAG	3 cut(s)	12, 53, 111

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.