RchiOBHm_Chr4g0409371

Sulfotransferase domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0006990
Physical Location & Seq
Forward (+)
32792274 .. 32792717
444 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ38039

Sequence Viewer

Length: 444 bp
ATGATTCTTGAAGGTATCATTTTGGCACAGCAAAGTTTTAGGGGTAGAGACAAAGACATTATCTTGGCCGCTTTTCCAAAATGTGGCACCACATGGACTAAGGCTCCCATGCTTGCTATCCAAAATCAAAACCGTTATGGTCAAGATCACTCATCCCAATCCTTTCATCCATTGCTCACAAAAAACCCTCATAATGTCGTACCTTTTCTAGAGTTACACGTTGATAAAGATAATCCAATTGCCTATCTAGACCCTCTTCTCTCACCTAGATTGCTCTCAACCTACAGTTCATACCTACCACTACCAAACTCGGTTTTGAATTATCCTAATGCTTGGATTGTGTGCAATGCAAGAAACCCTAAAGTTGTTCTTGTTTCTCTATGGGCCTTTCATCTCAAAACAAGACCACCAAATTCAAATAACAAACTTTGGCAACGTACGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Sulfotransfer_1

Protein Analysis

147

Amino Acids

16.77

Weight (kDa)

9.69

Isoelectric Point (pI)

35.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Sulfotransfer_1 PF00685 17 - 145 9.4e-19 Sulfotransferase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 86
AccB7I CCANNNNNTGG 1 cut(s) 83
AciI CCGC 1 cut(s) 69
AcoI YGGCCR 1 cut(s) 66
AcsI RAATTY 1 cut(s) 412
AfaI GTAC 2 cut(s) 201, 439
AfiI CCNNNNNNNGG 1 cut(s) 83
AflIII ACRYGT 1 cut(s) 217
AgsI TTSAA 3 cut(s) 11, 319, 417
Alw26I GTCTC 1 cut(s) 42
AoxI GGCC 2 cut(s) 66, 384
ApoI RAATTY 1 cut(s) 412
AspS9I GGNCC 1 cut(s) 384
AsuHPI GGTGA 1 cut(s) 255
BanI GGYRCC 1 cut(s) 86
BcoDI GTCTC 1 cut(s) 42
BfaI CTAG 3 cut(s) 209, 248, 267
BfmI CTRYAG 1 cut(s) 283
BisI GCNGC 1 cut(s) 69
BlsI GCNGC 1 cut(s) 70
BmgT120I GGNCC 1 cut(s) 384
BmiI GGNNCC 2 cut(s) 88, 105
BsaAI YACGTR 1 cut(s) 441
BsaXI ACNNNNNCTCC 2 cut(s) 88, 118
Bsc4I CCNNNNNNNGG 1 cut(s) 83
Bse3DI GCAATG 2 cut(s) 170, 352
BseGI GGATG 2 cut(s) 152, 166
BseLI CCNNNNNNNGG 1 cut(s) 83
BseMI GCAATG 2 cut(s) 170, 352
BshFI GGCC 2 cut(s) 68, 386
BshNI GGYRCC 1 cut(s) 86
BsiWI CGTACG 1 cut(s) 437
BslI CCNNNNNNNGG 1 cut(s) 83
BsmAI GTCTC 1 cut(s) 42
BsnI GGCC 2 cut(s) 68, 386
Bsp143I GATC 1 cut(s) 145
BspACI CCGC 1 cut(s) 69
BspANI GGCC 2 cut(s) 68, 386
BspLI GGNNCC 2 cut(s) 88, 105
BspT107I GGYRCC 1 cut(s) 86
BsrDI GCAATG 2 cut(s) 170, 352
BssMI GATC 1 cut(s) 145
Bst4CI ACNGT 2 cut(s) 134, 287
Bst6I CTCTTC 1 cut(s) 261
BstBAI YACGTR 1 cut(s) 441
BstC8I GCNNGC 1 cut(s) 114
BstDEI CTNAG 1 cut(s) 99
BstF5I GGATG 2 cut(s) 152, 166
BstKTI GATC 1 cut(s) 148
BstMAI GTCTC 1 cut(s) 42
BstMBI GATC 1 cut(s) 145
BstSFI CTRYAG 1 cut(s) 283
BsuRI GGCC 2 cut(s) 68, 386
BtsCI GGATG 2 cut(s) 152, 166
Cac8I GCNNGC 1 cut(s) 114
Cfr13I GGNCC 1 cut(s) 384
Csp6I GTAC 2 cut(s) 200, 438
CviAII CATG 2 cut(s) 93, 109
CviJI RGCY 3 cut(s) 68, 104, 386
CviKI_1 RGCY 3 cut(s) 68, 104, 386
CviQI GTAC 2 cut(s) 200, 438
DdeI CTNAG 1 cut(s) 99
DpnI GATC 1 cut(s) 147
DpnII GATC 1 cut(s) 145
EaeI YGGCCR 1 cut(s) 66
Eam1104I CTCTTC 1 cut(s) 261
EarI CTCTTC 1 cut(s) 261
FaeI CATG 2 cut(s) 96, 112
FaiI YATR 6 cut(s) 94, 110, 138, 192, 292, 382
FalI AAGNNNNNCTT 2 cut(s) 354, 386
FatI CATG 2 cut(s) 92, 108
Fnu4HI GCNGC 1 cut(s) 69
FokI GGATG 2 cut(s) 139, 153
Fsp4HI GCNGC 1 cut(s) 69
FspBI CTAG 3 cut(s) 209, 248, 267
GluI GCNGC 1 cut(s) 69
HaeIII GGCC 2 cut(s) 68, 386
Hin1II CATG 2 cut(s) 96, 112
HinfI GANTC 1 cut(s) 4
HphI GGTGA 1 cut(s) 255
Hpy188III TCNNGA 4 cut(s) 8, 143, 209, 248
HpyAV CCTTC 1 cut(s) 5
HpyCH4III ACNGT 2 cut(s) 134, 287
HpyCH4IV ACGT 3 cut(s) 219, 436, 440
HpyCH4V TGCA 2 cut(s) 345, 350
HpyF3I CTNAG 1 cut(s) 99
HpySE526I ACGT 3 cut(s) 219, 436, 440
Hsp92II CATG 2 cut(s) 96, 112
Kzo9I GATC 1 cut(s) 145
LmnI GCTCC 1 cut(s) 109
MaeI CTAG 3 cut(s) 209, 248, 267
MaeII ACGT 3 cut(s) 219, 436, 440
MaeIII GTNAC 1 cut(s) 213
MalI GATC 1 cut(s) 147
MboI GATC 1 cut(s) 145
MboII GAAGA 1 cut(s) 248
MfeI CAATTG 1 cut(s) 237
MluCI AATT 3 cut(s) 237, 319, 412
MnlI CCTC 2 cut(s) 198, 264
MunI CAATTG 1 cut(s) 237
NdeII GATC 1 cut(s) 145
NlaIII CATG 2 cut(s) 96, 112
NlaIV GGNNCC 2 cut(s) 88, 105
PfeI GAWTC 1 cut(s) 4
Pfl23II CGTACG 1 cut(s) 437
PflMI CCANNNNNTGG 1 cut(s) 83
PkrI GCNGC 1 cut(s) 70
Ppu21I YACGTR 1 cut(s) 441
PspLI CGTACG 1 cut(s) 437
PspN4I GGNNCC 2 cut(s) 88, 105
PspPI GGNCC 1 cut(s) 384
RsaI GTAC 2 cut(s) 201, 439
RsaNI GTAC 2 cut(s) 200, 438
SatI GCNGC 1 cut(s) 69
Sau3AI GATC 1 cut(s) 145
Sau96I GGNCC 1 cut(s) 384
SetI ASST 8 cut(s) 16, 205, 222, 268, 284, 297, 439, 443
SfcI CTRYAG 1 cut(s) 283
Sse9I AATT 3 cut(s) 237, 319, 412
SsiI CCGC 1 cut(s) 69
SspMI CTAG 3 cut(s) 209, 248, 267
TaaI ACNGT 2 cut(s) 134, 287
TaiI ACGT 3 cut(s) 222, 439, 443
TasI AATT 3 cut(s) 237, 319, 412
TauI GCSGC 1 cut(s) 71
TfiI GAWTC 1 cut(s) 4
TspDTI ATGAA 3 cut(s) 155, 279, 380
Van91I CCANNNNNTGG 1 cut(s) 83
XapI RAATTY 1 cut(s) 412
XbaI TCTAGA 2 cut(s) 208, 247
XspI CTAG 3 cut(s) 209, 248, 267
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.