Rmu_sc0003610.1_g000024

sulfotransferase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003610.1
Physical Location & Seq
Reverse (-)
98258 .. 99010
753 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003610.1_g000024.1.cds

Sequence Viewer

Length: 753 bp
atgtctgctatccaaaatcgaaattgccaatcccaatcccatcatccattgctcacaaataatcctcatgcttgtgtacccttcctagagttgcaagttcacaaagataacccaatcgcctacctagaatctcttccctcacctagattgctcgcaacccacatttcatacccatcattaccagactccattttgagtagttcgggttcacggattgtgagcattgcaaggaaccctaaagatgttcttgtttccctatgggagtttacacagaaaataagacaaaaaacttcaaacggccaacttccacctcttcctatagaagaggcatttgaattgttttgtaaagggccttcgattggaggaccctttcgggatcatcttctgggttattgggaagcaagcaaggaaaacccaaataaggtcttatttttgaagtatgaggatatgaaggacacagaaacatgtgtaaagaggttggcagagttcatgcatcatccattttcgttagaagaagggagactcggtgttgttcaagaagtaatatacttgtgcagtttcgagaatttgaaaaatttggaggtgaacaaaagtgggactgtcaagttaacctctacgacggtactcgataacgatatcttcttccaaaaaggccaggttggggactccaaaaaccacctaacacctgagatgctccagcatcttgacaaaatcacagagcacaagttgggcagtgctggtttgaagttttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

250

Amino Acids

28.17

Weight (kDa)

6.59

Isoelectric Point (pI)

46.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 384
AcoI YGGCCR 1 cut(s) 298
AcsI RAATTY 2 cut(s) 565, 574
AfaI GTAC 2 cut(s) 78, 624
AfiI CCNNNNNNNGG 3 cut(s) 359, 421, 661
AflIII ACRYGT 1 cut(s) 464
AgsI TTSAA 6 cut(s) 294, 335, 436, 536, 571, 745
AjnI CCWGG 1 cut(s) 654
Alw21I GWGCWC 1 cut(s) 723
Alw26I GTCTC 1 cut(s) 514
AlwI GGATC 1 cut(s) 384
AoxI GGCC 3 cut(s) 298, 350, 652
ApoI RAATTY 2 cut(s) 565, 574
Asp700I GAANNNNTTC 1 cut(s) 132
AspS9I GGNCC 2 cut(s) 350, 365
AsuHPI GGTGA 2 cut(s) 132, 595
AvaII GGWCC 1 cut(s) 365
BarI GAAGNNNNNNTAC 2 cut(s) 337, 369
Bbv12I GWGCWC 1 cut(s) 723
BccI CCATC 2 cut(s) 48, 181
BceAI ACGGC 1 cut(s) 313
BciT130I CCWGG 1 cut(s) 656
BcoDI GTCTC 1 cut(s) 514
BfaI CTAG 3 cut(s) 86, 125, 144
BfmI CTRYAG 1 cut(s) 318
Bme1390I CCNGG 1 cut(s) 656
Bme18I GGWCC 1 cut(s) 365
BmgT120I GGNCC 2 cut(s) 350, 365
BmiI GGNNCC 2 cut(s) 233, 367
BmrFI CCNGG 1 cut(s) 656
BmsI GCATC 3 cut(s) 502, 681, 709
BpmI CTGGAG 1 cut(s) 680
BsaXI ACNNNNNCTCC 2 cut(s) 511, 541
Bsc4I CCNNNNNNNGG 3 cut(s) 359, 421, 661
Bse3DI GCAATG 2 cut(s) 47, 222
BseBI CCWGG 1 cut(s) 656
BseGI GGATG 2 cut(s) 43, 496
BseLI CCNNNNNNNGG 3 cut(s) 359, 421, 661
BseMI GCAATG 2 cut(s) 47, 222
BseMII CTCAG 1 cut(s) 678
BsgI GTGCAG 1 cut(s) 574
BshFI GGCC 3 cut(s) 300, 352, 654
BsiHKAI GWGCWC 1 cut(s) 723
BslFI GGGAC 2 cut(s) 610, 677
BslI CCNNNNNNNGG 3 cut(s) 359, 421, 661
BsmAI GTCTC 1 cut(s) 514
BsmFI GGGAC 2 cut(s) 610, 677
BsnI GGCC 3 cut(s) 300, 352, 654
Bsp1286I GDGCHC 1 cut(s) 723
Bsp143I GATC 1 cut(s) 376
BspANI GGCC 3 cut(s) 300, 352, 654
BspCNI CTCAG 1 cut(s) 679
BspLI GGNNCC 2 cut(s) 233, 367
BspPI GGATC 1 cut(s) 384
BsrDI GCAATG 2 cut(s) 47, 222
BssMI GATC 1 cut(s) 376
Bst2UI CCWGG 1 cut(s) 656
Bst4CI ACNGT 2 cut(s) 601, 622
Bst6I CTCTTC 3 cut(s) 138, 318, 318
BstC8I GCNNGC 2 cut(s) 153, 403
BstDEI CTNAG 1 cut(s) 687
BstF5I GGATG 2 cut(s) 43, 496
BstKTI GATC 1 cut(s) 379
BstMAI GTCTC 1 cut(s) 514
BstMBI GATC 1 cut(s) 376
BstNI CCWGG 1 cut(s) 656
BstNSI RCATGY 1 cut(s) 468
BstSCI CCNGG 1 cut(s) 654
BstSFI CTRYAG 1 cut(s) 318
BsuRI GGCC 3 cut(s) 300, 352, 654
BtsCI GGATG 2 cut(s) 43, 496
BtsI GCAGTG 1 cut(s) 739
BtsIMutI CAGTG 1 cut(s) 739
Cac8I GCNNGC 2 cut(s) 153, 403
Cfr13I GGNCC 2 cut(s) 350, 365
Csp6I GTAC 2 cut(s) 77, 623
CviAII CATG 3 cut(s) 68, 465, 490
CviJI RGCY 3 cut(s) 300, 352, 654
CviKI_1 RGCY 3 cut(s) 300, 352, 654
CviQI GTAC 2 cut(s) 77, 623
DdeI CTNAG 1 cut(s) 687
DpnI GATC 1 cut(s) 378
DpnII GATC 1 cut(s) 376
EaeI YGGCCR 1 cut(s) 298
Eam1104I CTCTTC 3 cut(s) 138, 318, 318
EarI CTCTTC 3 cut(s) 138, 318, 318
Eco32I GATATC 1 cut(s) 637
Eco47I GGWCC 1 cut(s) 365
EcoO109I RGGNCCY 2 cut(s) 350, 365
EcoRII CCWGG 1 cut(s) 654
EcoRV GATATC 1 cut(s) 637
EcoT22I ATGCAT 1 cut(s) 495
FaeI CATG 3 cut(s) 71, 468, 493
FaiI YATR 9 cut(s) 69, 169, 259, 320, 441, 449, 466, 491, 547
FalI AAGNNNNNCTT 2 cut(s) 231, 263
FaqI GGGAC 2 cut(s) 610, 677
FatI CATG 3 cut(s) 67, 464, 489
FokI GGATG 2 cut(s) 30, 483
FspBI CTAG 3 cut(s) 86, 125, 144
GsuI CTGGAG 1 cut(s) 680
HaeIII GGCC 3 cut(s) 300, 352, 654
Hin1II CATG 3 cut(s) 71, 468, 493
HincII GTYRAC 1 cut(s) 609
HindII GTYRAC 1 cut(s) 609
HinfI GANTC 4 cut(s) 128, 185, 522, 665
HpaI GTTAAC 1 cut(s) 609
HphI GGTGA 2 cut(s) 132, 595
Hpy166II GTNNAC 6 cut(s) 77, 100, 209, 267, 586, 609
Hpy188III TCNNGA 4 cut(s) 374, 536, 562, 704
Hpy8I GTNNAC 6 cut(s) 77, 100, 209, 267, 586, 609
Hpy99I CGWCG 1 cut(s) 622
HpyAV CCTTC 4 cut(s) 91, 363, 445, 509
HpyCH4III ACNGT 2 cut(s) 601, 622
HpyCH4V TGCA 4 cut(s) 94, 227, 493, 555
HpyF3I CTNAG 1 cut(s) 687
Hsp92II CATG 3 cut(s) 71, 468, 493
KspAI GTTAAC 1 cut(s) 609
Kzo9I GATC 1 cut(s) 376
LmnI GCTCC 1 cut(s) 699
LpnPI CCDG 7 cut(s) 195, 371, 641, 668, 699, 710, 723
LweI GCATC 3 cut(s) 502, 681, 709
MaeI CTAG 3 cut(s) 86, 125, 144
MalI GATC 1 cut(s) 378
MboI GATC 1 cut(s) 376
MboII GAAGA 7 cut(s) 125, 305, 335, 374, 524, 631, 634
MhlI GDGCHC 1 cut(s) 723
MluCI AATT 4 cut(s) 22, 335, 565, 574
MlyI GAGTC 3 cut(s) 179, 516, 659
MnlI CCTC 9 cut(s) 75, 148, 319, 321, 356, 436, 468, 574, 622
Mph1103I ATGCAT 1 cut(s) 495
MroXI GAANNNNTTC 1 cut(s) 132
MseI TTAA 1 cut(s) 608
MslI CAYNNNNRTG 1 cut(s) 72
MspR9I CCNGG 1 cut(s) 656
MvaI CCWGG 1 cut(s) 656
NdeII GATC 1 cut(s) 376
NlaIII CATG 3 cut(s) 71, 468, 493
NlaIV GGNNCC 2 cut(s) 233, 367
NsiI ATGCAT 1 cut(s) 495
NspI RCATGY 1 cut(s) 468
PciI ACATGT 1 cut(s) 464
PdmI GAANNNNTTC 1 cut(s) 132
PfeI GAWTC 1 cut(s) 128
PleI GAGTC 3 cut(s) 179, 516, 659
PpsI GAGTC 3 cut(s) 179, 516, 659
PpuMI RGGWCCY 1 cut(s) 365
PscI ACATGT 1 cut(s) 464
Psp5II RGGWCCY 1 cut(s) 365
Psp6I CCWGG 1 cut(s) 654
PspGI CCWGG 1 cut(s) 654
PspN4I GGNNCC 2 cut(s) 233, 367
PspPI GGNCC 2 cut(s) 350, 365
PspPPI RGGWCCY 1 cut(s) 365
PsrI GAACNNNNNNTAC 2 cut(s) 190, 222
RsaI GTAC 2 cut(s) 78, 624
RsaNI GTAC 2 cut(s) 77, 623
RseI CAYNNNNRTG 1 cut(s) 72
SaqAI TTAA 1 cut(s) 608
Sau3AI GATC 1 cut(s) 376
Sau96I GGNCC 2 cut(s) 350, 365
SchI GAGTC 3 cut(s) 179, 516, 659
ScrFI CCNGG 1 cut(s) 656
SduI GDGCHC 1 cut(s) 723
SfaNI GCATC 3 cut(s) 502, 681, 709
SfcI CTRYAG 1 cut(s) 318
SinI GGWCC 1 cut(s) 365
SmiMI CAYNNNNRTG 1 cut(s) 72
Sse9I AATT 4 cut(s) 22, 335, 565, 574
SspMI CTAG 3 cut(s) 86, 125, 144
StyD4I CCNGG 1 cut(s) 654
TaaI ACNGT 2 cut(s) 601, 622
TaqI TCGA 4 cut(s) 19, 356, 561, 627
TasI AATT 4 cut(s) 22, 335, 565, 574
TfiI GAWTC 1 cut(s) 128
Tru1I TTAA 1 cut(s) 608
Tru9I TTAA 1 cut(s) 608
TscAI CASTG 1 cut(s) 739
TspDTI ATGAA 3 cut(s) 156, 464, 478
TspGWI ACGGA 1 cut(s) 226
TspRI CASTG 1 cut(s) 739
VpaK11BI GGWCC 1 cut(s) 365
XapI RAATTY 2 cut(s) 565, 574
XceI RCATGY 1 cut(s) 468
XmnI GAANNNNTTC 1 cut(s) 132
XspI CTAG 3 cut(s) 86, 125, 144
Zsp2I ATGCAT 1 cut(s) 495
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.