Rw7G004980

sulfotransferase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
OG0006990
Physical Location & Seq
Reverse (-)
4183741 .. 4184502
762 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G004980.1

Sequence Viewer

Length: 729 bp
ATGTCTGCTATCCAAAATCGAAATTGCCAATCCCGATCCCATCATCCATTGCTCACAAACAATCCTCATGCTTGTGTACCCTTCCTAGAGTTGCAAGTTCACAAAGATAACCCAATCGCCTACCTAGAATCTCTTCCCTCACCTAGATTGCTCGCAACCCACATTTCATACCCATCATTACCAGACTCCATTTTGAGTAGTTCGGGTACATGGATTGTGAGTATTGCAAGGAACCCTAAAGATGTTCTTGTTTCCCTATGGGAGTTTAGTCAGTTTACACAGAAAATAAGACAAAAAACTTCAAACGGCCAACTTCCACCTCTTCCTATAGAAGAGGCATTTGAATTGTTTTGTAAAGGGCCTTCGATTGGAGGACCCTTTTGGGATCATGTTCTGGGTTATTGGGAAGCAAGCAAGGAAAACCCAAATAAGGTCTTATTTTTGAAGTATGAGGATATGAAGGACACAGAAAAATGTGTAAAGAGGTTGGCAGAGTTCATGCATCATCCATTTTCGTTAGAAGAAGGGAGACTCGGTGTTAATTTGAAAAATTTGGAGGTGAACAAAAGTGGGACTGTCAATTTAACCTCTACGACGGTACTCGATAACGATATCTTCTTCCGAAAAGGCCAGGTTGGGGACTCCAAAAACCACCTAACACCTGAGATGCTCCAGCATCTTGACAAAATCACAGAGCACAAGTTGGGCAGTGCTGGTTTGAAGTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

242

Amino Acids

27.35

Weight (kDa)

7.18

Isoelectric Point (pI)

45.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Sulfotransfer_1 PF00685 2 - 236 1.3e-48 Sulfotransferase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 30, 393
AcoI YGGCCR 1 cut(s) 307
AcsI RAATTY 1 cut(s) 550
AfaI GTAC 3 cut(s) 78, 208, 600
AfiI CCNNNNNNNGG 3 cut(s) 368, 430, 637
AgsI TTSAA 5 cut(s) 303, 344, 445, 547, 721
AjnI CCWGG 1 cut(s) 630
Alw21I GWGCWC 1 cut(s) 699
Alw26I GTCTC 1 cut(s) 523
AlwI GGATC 2 cut(s) 30, 393
AoxI GGCC 3 cut(s) 307, 359, 628
ApoI RAATTY 1 cut(s) 550
Asp700I GAANNNNTTC 1 cut(s) 132
AspS9I GGNCC 2 cut(s) 359, 374
AsuHPI GGTGA 2 cut(s) 132, 571
AvaII GGWCC 1 cut(s) 374
BarI GAAGNNNNNNTAC 2 cut(s) 346, 378
Bbv12I GWGCWC 1 cut(s) 699
BccI CCATC 2 cut(s) 48, 181
BceAI ACGGC 1 cut(s) 322
BciT130I CCWGG 1 cut(s) 632
BcoDI GTCTC 1 cut(s) 523
BfaI CTAG 3 cut(s) 86, 125, 144
BfmI CTRYAG 1 cut(s) 327
Bme1390I CCNGG 1 cut(s) 632
Bme18I GGWCC 1 cut(s) 374
BmgT120I GGNCC 2 cut(s) 359, 374
BmiI GGNNCC 2 cut(s) 233, 376
BmrFI CCNGG 1 cut(s) 632
BmsI GCATC 3 cut(s) 511, 657, 685
BpmI CTGGAG 1 cut(s) 656
BsaXI ACNNNNNCTCC 2 cut(s) 520, 550
Bsc4I CCNNNNNNNGG 3 cut(s) 368, 430, 637
Bse3DI GCAATG 1 cut(s) 47
BseBI CCWGG 1 cut(s) 632
BseGI GGATG 2 cut(s) 43, 505
BseLI CCNNNNNNNGG 3 cut(s) 368, 430, 637
BseMI GCAATG 1 cut(s) 47
BseMII CTCAG 1 cut(s) 654
BshFI GGCC 3 cut(s) 309, 361, 630
BsiHKAI GWGCWC 1 cut(s) 699
BslFI GGGAC 2 cut(s) 586, 653
BslI CCNNNNNNNGG 3 cut(s) 368, 430, 637
BsmAI GTCTC 1 cut(s) 523
BsmFI GGGAC 2 cut(s) 586, 653
BsnI GGCC 3 cut(s) 309, 361, 630
Bsp1286I GDGCHC 1 cut(s) 699
Bsp143I GATC 2 cut(s) 35, 385
BspANI GGCC 3 cut(s) 309, 361, 630
BspCNI CTCAG 1 cut(s) 655
BspLI GGNNCC 2 cut(s) 233, 376
BspPI GGATC 2 cut(s) 30, 393
BsrDI GCAATG 1 cut(s) 47
BssMI GATC 2 cut(s) 35, 385
Bst2UI CCWGG 1 cut(s) 632
Bst4CI ACNGT 2 cut(s) 577, 598
Bst6I CTCTTC 3 cut(s) 138, 327, 327
BstC8I GCNNGC 2 cut(s) 153, 412
BstDEI CTNAG 1 cut(s) 663
BstF5I GGATG 2 cut(s) 43, 505
BstKTI GATC 2 cut(s) 38, 388
BstMAI GTCTC 1 cut(s) 523
BstMBI GATC 2 cut(s) 35, 385
BstNI CCWGG 1 cut(s) 632
BstSCI CCNGG 1 cut(s) 630
BstSFI CTRYAG 1 cut(s) 327
BsuRI GGCC 3 cut(s) 309, 361, 630
BtsCI GGATG 2 cut(s) 43, 505
BtsI GCAGTG 1 cut(s) 715
BtsIMutI CAGTG 1 cut(s) 715
Cac8I GCNNGC 2 cut(s) 153, 412
Cfr13I GGNCC 2 cut(s) 359, 374
Csp6I GTAC 3 cut(s) 77, 207, 599
CviAII CATG 4 cut(s) 68, 210, 389, 499
CviJI RGCY 3 cut(s) 309, 361, 630
CviKI_1 RGCY 3 cut(s) 309, 361, 630
CviQI GTAC 3 cut(s) 77, 207, 599
DdeI CTNAG 1 cut(s) 663
DpnI GATC 2 cut(s) 37, 387
DpnII GATC 2 cut(s) 35, 385
EaeI YGGCCR 1 cut(s) 307
Eam1104I CTCTTC 3 cut(s) 138, 327, 327
EarI CTCTTC 3 cut(s) 138, 327, 327
Eco32I GATATC 1 cut(s) 613
Eco47I GGWCC 1 cut(s) 374
EcoO109I RGGNCCY 2 cut(s) 359, 374
EcoRII CCWGG 1 cut(s) 630
EcoRV GATATC 1 cut(s) 613
EcoT22I ATGCAT 1 cut(s) 504
FaeI CATG 4 cut(s) 71, 213, 392, 502
FaiI YATR 9 cut(s) 69, 169, 211, 259, 329, 390, 450, 458, 500
FalI AAGNNNNNCTT 2 cut(s) 231, 263
FaqI GGGAC 2 cut(s) 586, 653
FatI CATG 4 cut(s) 67, 209, 388, 498
FokI GGATG 2 cut(s) 30, 492
FspBI CTAG 3 cut(s) 86, 125, 144
GsuI CTGGAG 1 cut(s) 656
HaeIII GGCC 3 cut(s) 309, 361, 630
Hin1II CATG 4 cut(s) 71, 213, 392, 502
HinfI GANTC 4 cut(s) 128, 185, 531, 641
HphI GGTGA 2 cut(s) 132, 571
Hpy166II GTNNAC 4 cut(s) 77, 100, 276, 562
Hpy188I TCNGA 1 cut(s) 623
Hpy188III TCNNGA 2 cut(s) 33, 680
Hpy8I GTNNAC 4 cut(s) 77, 100, 276, 562
Hpy99I CGWCG 1 cut(s) 598
HpyAV CCTTC 4 cut(s) 91, 372, 454, 518
HpyCH4III ACNGT 2 cut(s) 577, 598
HpyCH4V TGCA 3 cut(s) 94, 227, 502
HpyF3I CTNAG 1 cut(s) 663
Hsp92II CATG 4 cut(s) 71, 213, 392, 502
Kzo9I GATC 2 cut(s) 35, 385
LmnI GCTCC 1 cut(s) 675
LpnPI CCDG 7 cut(s) 195, 380, 617, 644, 675, 686, 699
LweI GCATC 3 cut(s) 511, 657, 685
MaeI CTAG 3 cut(s) 86, 125, 144
MalI GATC 2 cut(s) 37, 387
MboI GATC 2 cut(s) 35, 385
MboII GAAGA 6 cut(s) 125, 314, 344, 533, 607, 610
MhlI GDGCHC 1 cut(s) 699
MluCI AATT 5 cut(s) 22, 344, 541, 550, 580
MlyI GAGTC 3 cut(s) 179, 525, 635
MnlI CCTC 9 cut(s) 75, 148, 328, 330, 365, 445, 477, 550, 598
Mph1103I ATGCAT 1 cut(s) 504
MroXI GAANNNNTTC 1 cut(s) 132
MseI TTAA 2 cut(s) 540, 584
MslI CAYNNNNRTG 1 cut(s) 72
MspR9I CCNGG 1 cut(s) 632
MvaI CCWGG 1 cut(s) 632
NdeII GATC 2 cut(s) 35, 385
NlaIII CATG 4 cut(s) 71, 213, 392, 502
NlaIV GGNNCC 2 cut(s) 233, 376
NsiI ATGCAT 1 cut(s) 504
PdmI GAANNNNTTC 1 cut(s) 132
PfeI GAWTC 1 cut(s) 128
PleI GAGTC 3 cut(s) 179, 525, 635
PpsI GAGTC 3 cut(s) 179, 525, 635
PpuMI RGGWCCY 1 cut(s) 374
Psp5II RGGWCCY 1 cut(s) 374
Psp6I CCWGG 1 cut(s) 630
PspGI CCWGG 1 cut(s) 630
PspN4I GGNNCC 2 cut(s) 233, 376
PspPI GGNCC 2 cut(s) 359, 374
PspPPI RGGWCCY 1 cut(s) 374
RsaI GTAC 3 cut(s) 78, 208, 600
RsaNI GTAC 3 cut(s) 77, 207, 599
RseI CAYNNNNRTG 1 cut(s) 72
SaqAI TTAA 2 cut(s) 540, 584
Sau3AI GATC 2 cut(s) 35, 385
Sau96I GGNCC 2 cut(s) 359, 374
SchI GAGTC 3 cut(s) 179, 525, 635
ScrFI CCNGG 1 cut(s) 632
SduI GDGCHC 1 cut(s) 699
SfaNI GCATC 3 cut(s) 511, 657, 685
SfcI CTRYAG 1 cut(s) 327
SinI GGWCC 1 cut(s) 374
SmiMI CAYNNNNRTG 1 cut(s) 72
Sse9I AATT 5 cut(s) 22, 344, 541, 550, 580
SspMI CTAG 3 cut(s) 86, 125, 144
StyD4I CCNGG 1 cut(s) 630
TaaI ACNGT 2 cut(s) 577, 598
TaqI TCGA 3 cut(s) 19, 365, 603
TasI AATT 5 cut(s) 22, 344, 541, 550, 580
TfiI GAWTC 1 cut(s) 128
Tru1I TTAA 2 cut(s) 540, 584
Tru9I TTAA 2 cut(s) 540, 584
TscAI CASTG 1 cut(s) 715
TspDTI ATGAA 3 cut(s) 156, 473, 487
TspRI CASTG 1 cut(s) 715
VpaK11BI GGWCC 1 cut(s) 374
XapI RAATTY 1 cut(s) 550
XmnI GAANNNNTTC 1 cut(s) 132
XspI CTAG 3 cut(s) 86, 125, 144
Zsp2I ATGCAT 1 cut(s) 504
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.