RchiOBHm_Chr4g0427481

rRNA-processing protein fcf2-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0006753
Physical Location & Seq
Reverse (-)
52735161 .. 52735582
422 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ39640

Sequence Viewer

Length: 306 bp
ATGGCGGATATCAAAGCAGTAGTTGGTCTCTCATGGGAACCAAAGATTCCGAATTTTTCATCGGAAACCAAAACTGGACTTACAGTTGATGCAAAACCTCAAGAAACCAATCACCTTTGGAAACCCGCCACACAGCTTGTGGATGGCCTCTTTGTGCCACCAAATAACCCCAAAACGCTGAACAAGTTGCAGAGGAAGCAACTCAAAGACACGACTGGCTCGAATTGGTTTGACATGCCTGCACCAACCATGACCCCAGAGTTGCAGAAAGATCTCCAATTACTCAAGGTACGTGCGGTACTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Fcf2

Protein Analysis

101

Amino Acids

11.31

Weight (kDa)

9.35

Isoelectric Point (pI)

34.23

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Fcf2 PF08698 69 - 101 6.8e-10 Fcf2 pre-rRNA processing
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 5, 126, 296
AcsI RAATTY 1 cut(s) 52
AfaI GTAC 2 cut(s) 291, 300
AluBI AGCT 1 cut(s) 136
AluI AGCT 1 cut(s) 136
Alw26I GTCTC 1 cut(s) 32
AoxI GGCC 1 cut(s) 145
ApoI RAATTY 1 cut(s) 52
AsuHPI GGTGA 1 cut(s) 104
BccI CCATC 1 cut(s) 137
BcoDI GTCTC 1 cut(s) 32
BfmI CTRYAG 1 cut(s) 302
BglII AGATCT 1 cut(s) 271
BmiI GGNNCC 1 cut(s) 39
BmsI GCATC 1 cut(s) 79
BpuEI CTTGAG 2 cut(s) 84, 269
BsaAI YACGTR 1 cut(s) 293
BsaI GGTCTC 1 cut(s) 32
Bse1I ACTGG 2 cut(s) 79, 220
BseGI GGATG 1 cut(s) 148
BseNI ACTGG 2 cut(s) 79, 220
BsgI GTGCAG 1 cut(s) 225
BshFI GGCC 1 cut(s) 147
BsmAI GTCTC 1 cut(s) 32
BsnI GGCC 1 cut(s) 147
Bso31I GGTCTC 1 cut(s) 32
Bsp143I GATC 1 cut(s) 271
BspACI CCGC 3 cut(s) 5, 126, 296
BspANI GGCC 1 cut(s) 147
BspLI GGNNCC 1 cut(s) 39
BspTNI GGTCTC 1 cut(s) 32
BsrI ACTGG 2 cut(s) 79, 220
BssMI GATC 1 cut(s) 271
Bst4CI ACNGT 1 cut(s) 85
BstBAI YACGTR 1 cut(s) 293
BstC8I GCNNGC 1 cut(s) 240
BstF5I GGATG 1 cut(s) 148
BstKTI GATC 1 cut(s) 274
BstMAI GTCTC 1 cut(s) 32
BstMBI GATC 1 cut(s) 271
BstMWI GCNNNNNNNGC 1 cut(s) 196
BstNSI RCATGY 1 cut(s) 238
BstSFI CTRYAG 1 cut(s) 302
BstX2I RGATCY 1 cut(s) 271
BstYI RGATCY 1 cut(s) 271
BsuRI GGCC 1 cut(s) 147
BtsCI GGATG 1 cut(s) 148
Cac8I GCNNGC 1 cut(s) 240
Csp6I GTAC 2 cut(s) 290, 299
CspCI CAANNNNNGTGG 2 cut(s) 118, 153
CviAII CATG 3 cut(s) 33, 235, 250
CviJI RGCY 3 cut(s) 136, 147, 219
CviKI_1 RGCY 3 cut(s) 136, 147, 219
CviQI GTAC 2 cut(s) 290, 299
DpnI GATC 1 cut(s) 273
DpnII GATC 1 cut(s) 271
EciI GGCGGA 1 cut(s) 20
Eco31I GGTCTC 1 cut(s) 32
Eco32I GATATC 1 cut(s) 10
EcoRV GATATC 1 cut(s) 10
FaeI CATG 3 cut(s) 36, 238, 253
FaiI YATR 4 cut(s) 34, 236, 251, 304
FatI CATG 3 cut(s) 32, 234, 249
FauI CCCGC 1 cut(s) 133
FokI GGATG 1 cut(s) 155
HaeIII GGCC 1 cut(s) 147
Hin1II CATG 3 cut(s) 36, 238, 253
HinfI GANTC 1 cut(s) 46
HphI GGTGA 1 cut(s) 104
Hpy188I TCNGA 2 cut(s) 51, 64
Hpy188III TCNNGA 1 cut(s) 101
HpyCH4III ACNGT 1 cut(s) 85
HpyCH4IV ACGT 1 cut(s) 292
HpyCH4V TGCA 4 cut(s) 92, 190, 242, 265
HpyF10VI GCNNNNNNNGC 1 cut(s) 196
HpySE526I ACGT 1 cut(s) 292
Hsp92II CATG 3 cut(s) 36, 238, 253
Kzo9I GATC 1 cut(s) 271
LpnPI CCDG 4 cut(s) 60, 201, 252, 270
LweI GCATC 1 cut(s) 79
MaeII ACGT 1 cut(s) 292
MalI GATC 1 cut(s) 273
MboI GATC 1 cut(s) 271
MflI RGATCY 1 cut(s) 271
MluCI AATT 3 cut(s) 52, 223, 278
MnlI CCTC 3 cut(s) 108, 158, 186
MwoI GCNNNNNNNGC 1 cut(s) 196
NdeII GATC 1 cut(s) 271
NlaIII CATG 3 cut(s) 36, 238, 253
NlaIV GGNNCC 1 cut(s) 39
NspI RCATGY 1 cut(s) 238
PcsI WCGNNNNNNNCGW 1 cut(s) 218
PfeI GAWTC 1 cut(s) 46
Ppu21I YACGTR 1 cut(s) 293
PspN4I GGNNCC 1 cut(s) 39
PsuI RGATCY 1 cut(s) 271
RsaI GTAC 2 cut(s) 291, 300
RsaNI GTAC 2 cut(s) 290, 299
Sau3AI GATC 1 cut(s) 271
SetI ASST 5 cut(s) 100, 117, 138, 291, 295
SfaNI GCATC 1 cut(s) 79
SfcI CTRYAG 1 cut(s) 302
SmlI CTYRAG 2 cut(s) 99, 284
SmoI CTYRAG 2 cut(s) 99, 284
Sse9I AATT 3 cut(s) 52, 223, 278
SsiI CCGC 3 cut(s) 5, 126, 296
TaaI ACNGT 1 cut(s) 85
TaiI ACGT 1 cut(s) 295
TaqI TCGA 1 cut(s) 221
TasI AATT 3 cut(s) 52, 223, 278
TfiI GAWTC 1 cut(s) 46
TspDTI ATGAA 1 cut(s) 48
XapI RAATTY 1 cut(s) 52
XceI RCATGY 1 cut(s) 238
XcmI CCANNNNNNNNNTGG 1 cut(s) 136
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.