Rmu_sc0000603.1_g000009

rRNA-processing protein fcf2-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000603.1
Physical Location & Seq
Reverse (-)
37876 .. 41135
3260 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000603.1_g000009.1.cds

Sequence Viewer

Length: 741 bp
atgggtatgggattttgttggaagttgatgaggtcgaggagggtttggagtggggcggtggcagtcgtgctatgtattggggtggtcggttggaattgcagttaccgaccacctttcgcgaagcagcgacgttggcctcttctccgctcactgattccaatggcggatatcaaagcagtagttggtctctcatgggagccaaagattccgaatttttcatcggcaaccaaacctagacttggagttgatgcaaaacctcaagaaaccaatcatctttggaaaccccccacccagcttgtggatggcctctttgtgccacccaataaccccaaaacgctgaacaagttgcagaggaagcaactcaaagacacaactggctcgaattggtttgacatgcctgcaccaaccatgaccccggagttgcagaaagatctccaattactcaagttaaggagtgtcatggatccaaagagacactacaagaagggtgattcgcaaacttccaagtatttccaggtgggaacggtggtagagtcctcatcagaattcttctcaggtagactaacaaagaaggaaaggaaggcaaccgttgcagaggagctgctttctgatcctgcccttgcgacctacaggaagcggaaggttcgtgagatcgaagagaagaatcgaccggctgataatgaaaaatggaagaataaagggaagacgtcctataagcgtgcaaagcaaagaaggcactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

246

Amino Acids

28.32

Weight (kDa)

10.31

Isoelectric Point (pI)

56.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 710
AccB7I CCANNNNNTGG 1 cut(s) 298
AccBSI CCGCTC 1 cut(s) 147
AccI GTMKAC 1 cut(s) 559
AccII CGCG 1 cut(s) 119
AciI CCGC 4 cut(s) 56, 145, 164, 637
AclWI GGATC 3 cut(s) 458, 471, 605
AcsI RAATTY 2 cut(s) 211, 545
AcyI GRCGYC 1 cut(s) 707
AfiI CCNNNNNNNGG 2 cut(s) 239, 298
AjnI CCWGG 1 cut(s) 513
AluBI AGCT 2 cut(s) 295, 601
AluI AGCT 2 cut(s) 295, 601
Alw26I GTCTC 2 cut(s) 191, 466
AlwI GGATC 3 cut(s) 458, 471, 605
AoxI GGCC 2 cut(s) 134, 304
ApeKI GCWGC 2 cut(s) 124, 601
ApoI RAATTY 2 cut(s) 211, 545
AsuC2I CCSGG 1 cut(s) 416
AsuHPI GGTGA 1 cut(s) 500
BamHI GGATCC 1 cut(s) 463
BbsI GAAGAC 1 cut(s) 710
BbvI GCAGC 2 cut(s) 136, 588
BccI CCATC 1 cut(s) 296
BciT130I CCWGG 1 cut(s) 515
BcnI CCSGG 1 cut(s) 416
BcoDI GTCTC 2 cut(s) 191, 466
BfaI CTAG 1 cut(s) 234
BfmI CTRYAG 1 cut(s) 628
BglII AGATCT 1 cut(s) 430
BisI GCNGC 2 cut(s) 125, 602
BlsI GCNGC 2 cut(s) 126, 603
Bme1390I CCNGG 2 cut(s) 416, 515
BmiI GGNNCC 2 cut(s) 198, 465
BmrFI CCNGG 2 cut(s) 416, 515
BmsI GCATC 1 cut(s) 238
BpiI GAAGAC 1 cut(s) 710
BpuEI CTTGAG 2 cut(s) 243, 428
BpuMI CCSGG 1 cut(s) 416
BsaHI GRCGYC 1 cut(s) 707
BsaI GGTCTC 1 cut(s) 191
BsaJI CCNNGG 1 cut(s) 414
Bsc4I CCNNNNNNNGG 2 cut(s) 239, 298
Bse118I RCCGGY 1 cut(s) 670
Bse1I ACTGG 1 cut(s) 379
BseBI CCWGG 1 cut(s) 515
BseDI CCNNGG 1 cut(s) 414
BseGI GGATG 1 cut(s) 307
BseLI CCNNNNNNNGG 2 cut(s) 239, 298
BseMII CTCAG 1 cut(s) 567
BseNI ACTGG 1 cut(s) 379
BseRI GAGGAG 2 cut(s) 52, 611
BseXI GCAGC 2 cut(s) 136, 588
BseYI CCCAGC 1 cut(s) 291
BsgI GTGCAG 1 cut(s) 384
Bsh1236I CGCG 1 cut(s) 119
Bsh1285I CGRYCG 1 cut(s) 671
BshFI GGCC 2 cut(s) 136, 306
BsiEI CGRYCG 1 cut(s) 671
BsiSI CCGG 2 cut(s) 416, 671
BslI CCNNNNNNNGG 2 cut(s) 239, 298
BsmAI GTCTC 2 cut(s) 191, 466
BsnI GGCC 2 cut(s) 136, 306
Bso31I GGTCTC 1 cut(s) 191
Bsp143I GATC 4 cut(s) 430, 463, 610, 651
Bsp68I TCGCGA 1 cut(s) 119
BspACI CCGC 4 cut(s) 56, 145, 164, 637
BspANI GGCC 2 cut(s) 136, 306
BspCNI CTCAG 1 cut(s) 566
BspFNI CGCG 1 cut(s) 119
BspLI GGNNCC 2 cut(s) 198, 465
BspPI GGATC 3 cut(s) 458, 471, 605
BspTNI GGTCTC 1 cut(s) 191
BsrBI CCGCTC 1 cut(s) 147
BsrFI RCCGGY 1 cut(s) 670
BsrI ACTGG 1 cut(s) 379
BssAI RCCGGY 1 cut(s) 670
BssECI CCNNGG 1 cut(s) 414
BssMI GATC 4 cut(s) 430, 463, 610, 651
BssNI GRCGYC 1 cut(s) 707
Bst2UI CCWGG 1 cut(s) 515
Bst4CI ACNGT 2 cut(s) 526, 589
Bst6I CTCTTC 2 cut(s) 144, 651
BstACI GRCGYC 1 cut(s) 707
BstAPI GCANNNNNTGC 1 cut(s) 590
BstC8I GCNNGC 2 cut(s) 399, 720
BstDEI CTNAG 1 cut(s) 553
BstF5I GGATG 1 cut(s) 307
BstFNI CGCG 1 cut(s) 119
BstKTI GATC 4 cut(s) 433, 466, 613, 654
BstMAI GTCTC 2 cut(s) 191, 466
BstMBI GATC 4 cut(s) 430, 463, 610, 651
BstMCI CGRYCG 1 cut(s) 671
BstMWI GCNNNNNNNGC 5 cut(s) 133, 355, 590, 724, 733
BstNI CCWGG 1 cut(s) 515
BstNSI RCATGY 1 cut(s) 397
BstSCI CCNGG 2 cut(s) 414, 513
BstSFI CTRYAG 1 cut(s) 628
BstUI CGCG 1 cut(s) 119
BstV1I GCAGC 2 cut(s) 136, 588
BstV2I GAAGAC 1 cut(s) 710
BstX2I RGATCY 2 cut(s) 430, 463
BstYI RGATCY 2 cut(s) 430, 463
BsuRI GGCC 2 cut(s) 136, 306
BtsCI GGATG 1 cut(s) 307
BtsIMutI CAGTG 1 cut(s) 149
BtuMI TCGCGA 1 cut(s) 119
Cac8I GCNNGC 2 cut(s) 399, 720
Cfr10I RCCGGY 1 cut(s) 670
CspCI CAANNNNNGTGG 2 cut(s) 277, 312
CviAII CATG 4 cut(s) 192, 394, 409, 460
CviJI RGCY 7 cut(s) 136, 199, 295, 306, 378, 601, 674
CviKI_1 RGCY 7 cut(s) 136, 199, 295, 306, 378, 601, 674
DdeI CTNAG 1 cut(s) 553
DpnI GATC 4 cut(s) 432, 465, 612, 653
DpnII GATC 4 cut(s) 430, 463, 610, 651
Eam1104I CTCTTC 2 cut(s) 144, 651
EarI CTCTTC 2 cut(s) 144, 651
EciI GGCGGA 1 cut(s) 179
Eco31I GGTCTC 1 cut(s) 191
Eco32I GATATC 1 cut(s) 169
EcoRI GAATTC 1 cut(s) 545
EcoRII CCWGG 1 cut(s) 513
EcoRV GATATC 1 cut(s) 169
FaeI CATG 4 cut(s) 195, 397, 412, 463
FaiI YATR 7 cut(s) 8, 73, 193, 395, 410, 461, 714
FatI CATG 4 cut(s) 191, 393, 408, 459
FblI GTMKAC 1 cut(s) 559
Fnu4HI GCNGC 2 cut(s) 125, 602
FokI GGATG 1 cut(s) 314
Fsp4HI GCNGC 2 cut(s) 125, 602
FspBI CTAG 1 cut(s) 234
GluI GCNGC 2 cut(s) 125, 602
GsaI CCCAGC 1 cut(s) 295
HaeIII GGCC 2 cut(s) 136, 306
HapII CCGG 2 cut(s) 416, 671
Hin1I GRCGYC 1 cut(s) 707
Hin1II CATG 4 cut(s) 195, 397, 412, 463
HinfI GANTC 5 cut(s) 154, 205, 491, 533, 664
HpaII CCGG 2 cut(s) 416, 671
HphI GGTGA 1 cut(s) 500
Hpy166II GTNNAC 1 cut(s) 560
Hpy188I TCNGA 3 cut(s) 210, 544, 610
Hpy188III TCNNGA 3 cut(s) 118, 260, 647
Hpy8I GTNNAC 1 cut(s) 560
Hpy99I CGWCG 1 cut(s) 132
HpyAV CCTTC 5 cut(s) 478, 565, 574, 634, 726
HpyCH4III ACNGT 2 cut(s) 526, 589
HpyCH4IV ACGT 2 cut(s) 130, 707
HpyCH4V TGCA 7 cut(s) 99, 251, 349, 401, 424, 593, 722
HpyF10VI GCNNNNNNNGC 5 cut(s) 133, 355, 590, 724, 733
HpyF3I CTNAG 1 cut(s) 553
HpySE526I ACGT 2 cut(s) 130, 707
Hsp92I GRCGYC 1 cut(s) 707
Hsp92II CATG 4 cut(s) 195, 397, 412, 463
Kzo9I GATC 4 cut(s) 430, 463, 610, 651
LmnI GCTCC 2 cut(s) 196, 598
Lsp1109I GCAGC 2 cut(s) 136, 588
LweI GCATC 1 cut(s) 238
MaeI CTAG 1 cut(s) 234
MaeII ACGT 2 cut(s) 130, 707
MaeIII GTNAC 1 cut(s) 101
MalI GATC 4 cut(s) 432, 465, 612, 653
MbiI CCGCTC 1 cut(s) 147
MboI GATC 4 cut(s) 430, 463, 610, 651
MboII GAAGA 6 cut(s) 131, 541, 668, 673, 703, 715
MflI RGATCY 2 cut(s) 430, 463
MluCI AATT 5 cut(s) 94, 211, 382, 437, 545
MlyI GAGTC 1 cut(s) 542
MmeI TCCRAC 1 cut(s) 71
MnlI CCTC 9 cut(s) 24, 30, 33, 147, 267, 317, 345, 547, 589
MseI TTAA 1 cut(s) 449
MspI CCGG 2 cut(s) 416, 671
MspR9I CCNGG 2 cut(s) 416, 515
MvaI CCWGG 1 cut(s) 515
MvnI CGCG 1 cut(s) 119
MwoI GCNNNNNNNGC 5 cut(s) 133, 355, 590, 724, 733
NciI CCSGG 1 cut(s) 416
NdeII GATC 4 cut(s) 430, 463, 610, 651
NlaIII CATG 4 cut(s) 195, 397, 412, 463
NlaIV GGNNCC 2 cut(s) 198, 465
NruI TCGCGA 1 cut(s) 119
NspI RCATGY 1 cut(s) 397
PfeI GAWTC 4 cut(s) 154, 205, 491, 664
PflMI CCANNNNNTGG 1 cut(s) 298
PkrI GCNGC 2 cut(s) 126, 603
PleI GAGTC 1 cut(s) 541
PpsI GAGTC 1 cut(s) 541
Psp6I CCWGG 1 cut(s) 513
PspFI CCCAGC 1 cut(s) 291
PspGI CCWGG 1 cut(s) 513
PspN4I GGNNCC 2 cut(s) 198, 465
PsuI RGATCY 2 cut(s) 430, 463
RruI TCGCGA 1 cut(s) 119
SaqAI TTAA 1 cut(s) 449
SatI GCNGC 2 cut(s) 125, 602
Sau3AI GATC 4 cut(s) 430, 463, 610, 651
SchI GAGTC 1 cut(s) 542
ScrFI CCNGG 2 cut(s) 416, 515
SfaNI GCATC 1 cut(s) 238
SfcI CTRYAG 1 cut(s) 628
SmlI CTYRAG 2 cut(s) 258, 443
SmoI CTYRAG 2 cut(s) 258, 443
Sse9I AATT 5 cut(s) 94, 211, 382, 437, 545
SsiI CCGC 4 cut(s) 56, 145, 164, 637
SspMI CTAG 1 cut(s) 234
StyD4I CCNGG 2 cut(s) 414, 513
TaaI ACNGT 2 cut(s) 526, 589
TaiI ACGT 2 cut(s) 133, 710
TaqI TCGA 4 cut(s) 35, 380, 654, 667
TasI AATT 5 cut(s) 94, 211, 382, 437, 545
TfiI GAWTC 4 cut(s) 154, 205, 491, 664
Tru1I TTAA 1 cut(s) 449
Tru9I TTAA 1 cut(s) 449
TscAI CASTG 1 cut(s) 156
TseI GCWGC 2 cut(s) 124, 601
TspDTI ATGAA 2 cut(s) 207, 696
TspRI CASTG 1 cut(s) 156
Van91I CCANNNNNTGG 1 cut(s) 298
XapI RAATTY 2 cut(s) 211, 545
XceI RCATGY 1 cut(s) 397
XcmI CCANNNNNNNNNTGG 2 cut(s) 295, 299
XmiI GTMKAC 1 cut(s) 559
XspI CTAG 1 cut(s) 234
ZraI GACGTC 1 cut(s) 708
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.