RchiOBHm_Chr5g0028651

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
22487467 .. 22487837
371 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30807

Sequence Viewer

Length: 162 bp
ATGTATGATTATATAGACGGATACCCATCTGAATTGTGGGAAGGCACTGCTGGAAATGCTATTACGTATTTATGTCCCCCTGCCGTCACATATTCCAAAAGATTGGGACTATGTTCAAAAGCCGTGATTGGTCCAGCTGCAATCTGTTTGCTGTGTTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

5.72

Weight (kDa)

4.78

Isoelectric Point (pI)

50.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 117
AluBI AGCT 1 cut(s) 137
AluI AGCT 1 cut(s) 137
ApeKI GCWGC 1 cut(s) 137
AspS9I GGNCC 1 cut(s) 131
AvaII GGWCC 1 cut(s) 131
BbvI GCAGC 1 cut(s) 124
BccI CCATC 1 cut(s) 34
BceAI ACGGC 2 cut(s) 68, 107
BciVI GTATCC 1 cut(s) 14
BfuI GTATCC 1 cut(s) 14
BisI GCNGC 1 cut(s) 138
BlsI GCNGC 1 cut(s) 139
Bme18I GGWCC 1 cut(s) 131
BmgT120I GGNCC 1 cut(s) 131
BsaAI YACGTR 1 cut(s) 66
BsaBI GATNNNNATC 1 cut(s) 25
Bse8I GATNNNNATC 1 cut(s) 25
BseJI GATNNNNATC 1 cut(s) 25
BseXI GCAGC 1 cut(s) 124
BslFI GGGAC 2 cut(s) 60, 120
BsmFI GGGAC 2 cut(s) 60, 120
BstBAI YACGTR 1 cut(s) 66
BstMWI GCNNNNNNNGC 1 cut(s) 56
BstSNI TACGTA 1 cut(s) 66
BstV1I GCAGC 1 cut(s) 124
BstXI CCANNNNNNTGG 1 cut(s) 103
BsuI GTATCC 1 cut(s) 14
BtsI GCAGTG 1 cut(s) 45
BtsIMutI CAGTG 1 cut(s) 45
Cfr13I GGNCC 1 cut(s) 131
CviJI RGCY 2 cut(s) 122, 137
CviKI_1 RGCY 2 cut(s) 122, 137
Eco105I TACGTA 1 cut(s) 66
Eco47I GGWCC 1 cut(s) 131
FaiI YATR 6 cut(s) 6, 12, 14, 73, 91, 112
FaqI GGGAC 2 cut(s) 60, 120
Fnu4HI GCNGC 1 cut(s) 138
Fsp4HI GCNGC 1 cut(s) 138
GluI GCNGC 1 cut(s) 138
Hpy188I TCNGA 1 cut(s) 31
HpyAV CCTTC 1 cut(s) 35
HpyCH4IV ACGT 1 cut(s) 65
HpyCH4V TGCA 1 cut(s) 140
HpyF10VI GCNNNNNNNGC 1 cut(s) 56
HpySE526I ACGT 1 cut(s) 65
LpnPI CCDG 3 cut(s) 36, 93, 147
Lsp1109I GCAGC 1 cut(s) 124
MaeII ACGT 1 cut(s) 65
MaeIII GTNAC 1 cut(s) 85
MluCI AATT 1 cut(s) 32
MspA1I CMGCKG 1 cut(s) 137
MwoI GCNNNNNNNGC 1 cut(s) 56
NmuCI GTSAC 1 cut(s) 85
PkrI GCNGC 1 cut(s) 139
Ppu21I YACGTR 1 cut(s) 66
PspPI GGNCC 1 cut(s) 131
PvuII CAGCTG 1 cut(s) 137
SatI GCNGC 1 cut(s) 138
Sau96I GGNCC 1 cut(s) 131
SetI ASST 2 cut(s) 68, 139
SgeI CNNG 4 cut(s) 63, 92, 136, 146
SinI GGWCC 1 cut(s) 131
SnaBI TACGTA 1 cut(s) 66
Sse9I AATT 1 cut(s) 32
TaiI ACGT 1 cut(s) 68
TasI AATT 1 cut(s) 32
TscAI CASTG 1 cut(s) 52
TseFI GTSAC 1 cut(s) 85
TseI GCWGC 1 cut(s) 137
Tsp45I GTSAC 1 cut(s) 85
TspGWI ACGGA 1 cut(s) 33
TspRI CASTG 1 cut(s) 52
VpaK11BI GGWCC 1 cut(s) 131
XcmI CCANNNNNNNNNTGG 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.