RLG00000013260

beta-galactosidase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr3
OG0008908
Physical Location & Seq
Reverse (-)
28839279 .. 28842061
2783 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000013260

Sequence Viewer

Length: 345 bp
ATGAAGCTAGATGAGGTTTCAACTAGGACCATGGAGGTATTAGTGGATGCTTTTTCTAGTTCTGTAAGGCTGTCTACCTTCTCCTATACTGAGTTGGATGATGAATGGGGTGAACAGAATAGAGATTGCCAGTATACAGAATTTCGTGGAGCAGTTCCTACTAGACTTGCACAGGACTTGGCATTTTCAGTTGCAAGGTTTATACAAAATGGTGATTCTTTTGCCAACTACTACATGTACCATGGAGGAAAGAATTTTGGCCGAACTGCTGGCTGTCCCTTCATTGCAACTAGCTATGACTATGATGCACCTCTAGATGAATATGGTATGCAAATAGGGGATTAG

Protein Analysis

115

Amino Acids

12.94

Weight (kDa)

4.37

Isoelectric Point (pI)

27.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro_35 PF01301 40 - 110 5.4e-20 Glycosyl hydrolases family 35
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 74, 134
AcoI YGGCCR 1 cut(s) 259
AcsI RAATTY 2 cut(s) 140, 253
AfaI GTAC 1 cut(s) 239
AflIII ACRYGT 1 cut(s) 234
AgsI TTSAA 1 cut(s) 21
AluBI AGCT 2 cut(s) 7, 294
AluI AGCT 2 cut(s) 7, 294
AoxI GGCC 1 cut(s) 259
ApoI RAATTY 2 cut(s) 140, 253
AspS9I GGNCC 1 cut(s) 27
AsuHPI GGTGA 2 cut(s) 122, 224
AvaII GGWCC 1 cut(s) 27
BfaI CTAG 6 cut(s) 8, 24, 57, 162, 291, 314
Bme18I GGWCC 1 cut(s) 27
BmgT120I GGNCC 1 cut(s) 27
BmsI GCATC 2 cut(s) 37, 295
BsaJI CCNNGG 2 cut(s) 30, 241
Bse1I ACTGG 1 cut(s) 130
Bse3DI GCAATG 1 cut(s) 282
BseDI CCNNGG 2 cut(s) 30, 241
BseGI GGATG 2 cut(s) 52, 103
BseMI GCAATG 1 cut(s) 282
BseMII CTCAG 1 cut(s) 81
BseNI ACTGG 1 cut(s) 130
BshFI GGCC 1 cut(s) 261
BslFI GGGAC 1 cut(s) 261
BsmFI GGGAC 1 cut(s) 261
BsnI GGCC 1 cut(s) 261
Bsp19I CCATGG 2 cut(s) 30, 241
BspANI GGCC 1 cut(s) 261
BspCNI CTCAG 1 cut(s) 82
BsrDI GCAATG 1 cut(s) 282
BsrI ACTGG 1 cut(s) 130
BssECI CCNNGG 2 cut(s) 30, 241
BssNAI GTATAC 1 cut(s) 135
BssT1I CCWWGG 2 cut(s) 30, 241
Bst1107I GTATAC 1 cut(s) 135
BstC8I GCNNGC 1 cut(s) 271
BstDEI CTNAG 1 cut(s) 90
BstDSI CCRYGG 2 cut(s) 30, 241
BstF5I GGATG 2 cut(s) 52, 103
BstNSI RCATGY 1 cut(s) 238
BstZ17I GTATAC 1 cut(s) 135
BsuRI GGCC 1 cut(s) 261
BtgI CCRYGG 2 cut(s) 30, 241
BtsCI GGATG 2 cut(s) 52, 103
Cac8I GCNNGC 1 cut(s) 271
Cfr13I GGNCC 1 cut(s) 27
Csp6I GTAC 1 cut(s) 238
CviAII CATG 3 cut(s) 31, 235, 242
CviJI RGCY 5 cut(s) 7, 70, 261, 273, 294
CviKI_1 RGCY 5 cut(s) 7, 70, 261, 273, 294
CviQI GTAC 1 cut(s) 238
DdeI CTNAG 1 cut(s) 90
EaeI YGGCCR 1 cut(s) 259
Eco130I CCWWGG 2 cut(s) 30, 241
Eco47I GGWCC 1 cut(s) 27
EcoT14I CCWWGG 2 cut(s) 30, 241
ErhI CCWWGG 2 cut(s) 30, 241
FaeI CATG 3 cut(s) 34, 238, 245
FaqI GGGAC 1 cut(s) 261
FatI CATG 3 cut(s) 30, 234, 241
FblI GTMKAC 2 cut(s) 74, 134
FokI GGATG 2 cut(s) 59, 110
FspBI CTAG 6 cut(s) 8, 24, 57, 162, 291, 314
HaeIII GGCC 1 cut(s) 261
Hin1II CATG 3 cut(s) 34, 238, 245
HinfI GANTC 1 cut(s) 215
HphI GGTGA 2 cut(s) 122, 224
Hpy166II GTNNAC 3 cut(s) 75, 113, 135
Hpy188III TCNNGA 1 cut(s) 314
Hpy8I GTNNAC 3 cut(s) 75, 113, 135
HpyAV CCTTC 2 cut(s) 88, 289
HpyCH4V TGCA 5 cut(s) 170, 194, 287, 308, 331
HpyF3I CTNAG 1 cut(s) 90
Hsp92II CATG 3 cut(s) 34, 238, 245
LmnI GCTCC 1 cut(s) 149
LpnPI CCDG 3 cut(s) 143, 158, 255
LweI GCATC 2 cut(s) 37, 295
MaeI CTAG 6 cut(s) 8, 24, 57, 162, 291, 314
MluCI AATT 2 cut(s) 140, 253
MmeI TCCRAC 1 cut(s) 75
MnlI CCTC 4 cut(s) 7, 28, 239, 321
NcoI CCATGG 2 cut(s) 30, 241
NlaIII CATG 3 cut(s) 34, 238, 245
NspI RCATGY 1 cut(s) 238
PciI ACATGT 1 cut(s) 234
PfeI GAWTC 1 cut(s) 215
PscI ACATGT 1 cut(s) 234
PspPI GGNCC 1 cut(s) 27
RsaI GTAC 1 cut(s) 239
RsaNI GTAC 1 cut(s) 238
Sau96I GGNCC 1 cut(s) 27
SetI ASST 7 cut(s) 9, 18, 39, 80, 200, 296, 313
SfaNI GCATC 2 cut(s) 37, 295
SinI GGWCC 1 cut(s) 27
Sse9I AATT 2 cut(s) 140, 253
SspMI CTAG 6 cut(s) 8, 24, 57, 162, 291, 314
StyI CCWWGG 2 cut(s) 30, 241
TasI AATT 2 cut(s) 140, 253
TfiI GAWTC 1 cut(s) 215
TspDTI ATGAA 4 cut(s) 17, 117, 271, 333
VpaK11BI GGWCC 1 cut(s) 27
XapI RAATTY 2 cut(s) 140, 253
XbaI TCTAGA 1 cut(s) 313
XceI RCATGY 1 cut(s) 238
XmiI GTMKAC 2 cut(s) 74, 134
XspI CTAG 6 cut(s) 8, 24, 57, 162, 291, 314
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.