Rroxscaffold_4G00299590

Mechanosensitive ion channel protein 10-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
19514902 .. 19522097
7196 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00299590.1

Sequence Viewer

Length: 216 bp
ATGCGAATCTCTGCCTTCTTCATCTCTATCAGAACTTGTGAGCACTCAAATTGTTACACTGATATTGGAAAGCTTCTGAAGATGAAGCTAGATAAGGTTTCAGCTAGGACCATAGAGGTATTGGTGGATGCTTTTTCTAGTTCTGCAAGGCTGTCCACCTTCTCCTATACTGAGTTGGACGATGAATGGGGTGAACAGAATAGAGATTGCCAGTGA

Protein Analysis

71

Amino Acids

8.17

Weight (kDa)

5.21

Isoelectric Point (pI)

13.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 98
AluBI AGCT 3 cut(s) 73, 88, 104
AluI AGCT 3 cut(s) 73, 88, 104
Alw21I GWGCWC 1 cut(s) 45
AspS9I GGNCC 1 cut(s) 108
AsuHPI GGTGA 1 cut(s) 203
AvaII GGWCC 1 cut(s) 108
Bbv12I GWGCWC 1 cut(s) 45
BfaI CTAG 3 cut(s) 89, 105, 138
Bme18I GGWCC 1 cut(s) 108
BmgT120I GGNCC 1 cut(s) 108
BmsI GCATC 1 cut(s) 118
Bse1I ACTGG 1 cut(s) 211
BseGI GGATG 1 cut(s) 133
BseMII CTCAG 1 cut(s) 162
BseNI ACTGG 1 cut(s) 211
BsiHKAI GWGCWC 1 cut(s) 45
Bsp1286I GDGCHC 1 cut(s) 45
BspCNI CTCAG 1 cut(s) 163
BsrI ACTGG 1 cut(s) 211
BstDEI CTNAG 1 cut(s) 171
BstF5I GGATG 1 cut(s) 133
BtsCI GGATG 1 cut(s) 133
BtsIMutI CAGTG 1 cut(s) 57
Cfr13I GGNCC 1 cut(s) 108
CviJI RGCY 4 cut(s) 73, 88, 104, 151
CviKI_1 RGCY 4 cut(s) 73, 88, 104, 151
DdeI CTNAG 1 cut(s) 171
Eco47I GGWCC 1 cut(s) 108
Eco57I CTGAAG 1 cut(s) 98
FaiI YATR 2 cut(s) 113, 168
FokI GGATG 1 cut(s) 140
FspBI CTAG 3 cut(s) 89, 105, 138
HindIII AAGCTT 1 cut(s) 71
HinfI GANTC 1 cut(s) 6
HphI GGTGA 1 cut(s) 203
Hpy166II GTNNAC 2 cut(s) 156, 194
Hpy188I TCNGA 2 cut(s) 32, 78
Hpy8I GTNNAC 2 cut(s) 156, 194
HpyAV CCTTC 2 cut(s) 25, 169
HpyCH4V TGCA 1 cut(s) 146
HpyF3I CTNAG 1 cut(s) 171
LweI GCATC 1 cut(s) 118
MaeI CTAG 3 cut(s) 89, 105, 138
MaeIII GTNAC 1 cut(s) 53
MboII GAAGA 2 cut(s) 10, 91
MhlI GDGCHC 1 cut(s) 45
MluCI AATT 1 cut(s) 49
MmeI TCCRAC 1 cut(s) 156
MnlI CCTC 1 cut(s) 109
PfeI GAWTC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 108
Sau96I GGNCC 1 cut(s) 108
SduI GDGCHC 1 cut(s) 45
SetI ASST 6 cut(s) 75, 90, 99, 106, 120, 161
SfaNI GCATC 1 cut(s) 118
SgeI CNNG 5 cut(s) 48, 101, 117, 150, 159
SinI GGWCC 1 cut(s) 108
Sse9I AATT 1 cut(s) 49
SspMI CTAG 3 cut(s) 89, 105, 138
TasI AATT 1 cut(s) 49
TfiI GAWTC 1 cut(s) 6
TscAI CASTG 1 cut(s) 64
TspDTI ATGAA 3 cut(s) 10, 98, 198
TspRI CASTG 1 cut(s) 64
VpaK11BI GGWCC 1 cut(s) 108
XcmI CCANNNNNNNNNTGG 1 cut(s) 118
XspI CTAG 3 cut(s) 89, 105, 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.