RchiOBHm_Chr5g0035011

Histone acetyltransferase type B catalytic

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
28945907 .. 28946409
503 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ31395

Sequence Viewer

Length: 138 bp
ATGCTGGAGTGCAGGCCAATGATTGCTTCAAGATTTATCTGGATTACCATATGGGTTAGCAGTATATCGTTTGATGCATATGTTGATATTGCATCTGAGGGCACAGCTGATTATGGTCCAGTTCAGTTGGCAAGTTGA

Protein Analysis

45

Amino Acids

5.01

Weight (kDa)

4.1

Isoelectric Point (pI)

31.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 30
AjuI GAANNNNNNNTTGG 2 cut(s) 10, 42
AluBI AGCT 1 cut(s) 107
AluI AGCT 1 cut(s) 107
AoxI GGCC 1 cut(s) 14
AspS9I GGNCC 1 cut(s) 116
AvaII GGWCC 1 cut(s) 116
BaeGI GKGCMC 1 cut(s) 104
Bme18I GGWCC 1 cut(s) 116
BmgT120I GGNCC 1 cut(s) 116
BmsI GCATC 2 cut(s) 64, 101
BpmI CTGGAG 1 cut(s) 26
Bse1I ACTGG 1 cut(s) 119
BseMII CTCAG 1 cut(s) 87
BseNI ACTGG 1 cut(s) 119
BseSI GKGCMC 1 cut(s) 104
BsgI GTGCAG 1 cut(s) 31
BshFI GGCC 1 cut(s) 16
BsnI GGCC 1 cut(s) 16
Bsp1286I GDGCHC 1 cut(s) 104
BspANI GGCC 1 cut(s) 16
BspCNI CTCAG 1 cut(s) 88
BsrI ACTGG 1 cut(s) 119
BstC8I GCNNGC 1 cut(s) 14
BstDEI CTNAG 1 cut(s) 96
BstSLI GKGCMC 1 cut(s) 104
BsuRI GGCC 1 cut(s) 16
Cac8I GCNNGC 1 cut(s) 14
Cfr13I GGNCC 1 cut(s) 116
CviJI RGCY 2 cut(s) 16, 107
CviKI_1 RGCY 2 cut(s) 16, 107
DdeI CTNAG 1 cut(s) 96
Eco47I GGWCC 1 cut(s) 116
EcoT22I ATGCAT 1 cut(s) 79
FaiI YATR 6 cut(s) 50, 52, 65, 79, 81, 114
FauNDI CATATG 2 cut(s) 50, 79
GsuI CTGGAG 1 cut(s) 26
HaeIII GGCC 1 cut(s) 16
Hpy188I TCNGA 1 cut(s) 97
Hpy188III TCNNGA 2 cut(s) 30, 40
HpyCH4V TGCA 3 cut(s) 12, 77, 92
HpyF3I CTNAG 1 cut(s) 96
LpnPI CCDG 2 cut(s) 25, 132
LweI GCATC 2 cut(s) 64, 101
MhlI GDGCHC 1 cut(s) 104
MnlI CCTC 1 cut(s) 91
Mph1103I ATGCAT 1 cut(s) 79
MspA1I CMGCKG 1 cut(s) 107
NdeI CATATG 2 cut(s) 50, 79
NsiI ATGCAT 1 cut(s) 79
PspPI GGNCC 1 cut(s) 116
PvuII CAGCTG 1 cut(s) 107
Sau96I GGNCC 1 cut(s) 116
SduI GDGCHC 1 cut(s) 104
SetI ASST 1 cut(s) 109
SfaNI GCATC 2 cut(s) 64, 101
SgeI CNNG 5 cut(s) 17, 25, 42, 52, 131
SinI GGWCC 1 cut(s) 116
VpaK11BI GGWCC 1 cut(s) 116
Zsp2I ATGCAT 1 cut(s) 79
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.