Rh7CG325800

LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Reverse (-)
35673772 .. 35676681
2910 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG325800.1

Sequence Viewer

Length: 261 bp
ATGGGTTGGGGATTTTTTTACTTGTGTCACCCAAAACTGGGAAAGTTATTACGTTTAGAAAAGGCTGAGTTTTTTCTAGAGGCCTGGTCCAACAGTGTCTGTGACTTTCACAACACATTTGAGGTTCTTTGCAGTATATACAGGGTCAAAGCACCTATTCTAAGCGACAGGACCATTAAGATTACAATATGGGTTAGCAGTATATCGTTTGATACATATGCTGATATTGCATCTGAGGGCACAGCTGATATGGTTCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

9.88

Weight (kDa)

5.82

Isoelectric Point (pI)

23.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 37, 38
AjnI CCWGG 1 cut(s) 83
AluBI AGCT 1 cut(s) 245
AluI AGCT 1 cut(s) 245
AlwNI CAGNNNCTG 1 cut(s) 99
AoxI GGCC 1 cut(s) 81
AspS9I GGNCC 2 cut(s) 87, 171
AsuHPI GGTGA 1 cut(s) 20
AvaII GGWCC 2 cut(s) 87, 171
BaeGI GKGCMC 1 cut(s) 242
BciT130I CCWGG 1 cut(s) 85
BfaI CTAG 2 cut(s) 77, 259
Bme1390I CCNGG 1 cut(s) 85
Bme18I GGWCC 2 cut(s) 87, 171
BmgT120I GGNCC 2 cut(s) 87, 171
BmrFI CCNGG 1 cut(s) 85
BmrI ACTGGG 1 cut(s) 47
BmsI GCATC 1 cut(s) 239
BmuI ACTGGG 1 cut(s) 47
Bsc4I CCNNNNNNNGG 2 cut(s) 37, 38
Bse1I ACTGG 1 cut(s) 42
BseBI CCWGG 1 cut(s) 85
BseLI CCNNNNNNNGG 2 cut(s) 37, 38
BseMII CTCAG 2 cut(s) 57, 225
BseNI ACTGG 1 cut(s) 42
BseSI GKGCMC 1 cut(s) 242
BshFI GGCC 1 cut(s) 83
BslI CCNNNNNNNGG 2 cut(s) 37, 38
BsnI GGCC 1 cut(s) 83
Bsp1286I GDGCHC 1 cut(s) 242
BspANI GGCC 1 cut(s) 83
BspCNI CTCAG 2 cut(s) 58, 226
BsrI ACTGG 1 cut(s) 42
Bst2UI CCWGG 1 cut(s) 85
Bst4CI ACNGT 1 cut(s) 95
BstDEI CTNAG 3 cut(s) 66, 161, 234
BstMWI GCNNNNNNNGC 1 cut(s) 227
BstNI CCWGG 1 cut(s) 85
BstSCI CCNGG 1 cut(s) 83
BstSLI GKGCMC 1 cut(s) 242
BsuRI GGCC 1 cut(s) 83
BtsIMutI CAGTG 1 cut(s) 100
CaiI CAGNNNCTG 1 cut(s) 99
Cfr13I GGNCC 2 cut(s) 87, 171
CviJI RGCY 3 cut(s) 65, 83, 245
CviKI_1 RGCY 3 cut(s) 65, 83, 245
DdeI CTNAG 3 cut(s) 66, 161, 234
Eco147I AGGCCT 1 cut(s) 83
Eco47I GGWCC 2 cut(s) 87, 171
EcoRII CCWGG 1 cut(s) 83
FaiI YATR 7 cut(s) 137, 139, 190, 203, 217, 219, 251
FauNDI CATATG 1 cut(s) 217
FspBI CTAG 2 cut(s) 77, 259
HaeIII GGCC 1 cut(s) 83
HphI GGTGA 1 cut(s) 20
Hpy166II GTNNAC 1 cut(s) 256
Hpy188I TCNGA 1 cut(s) 235
Hpy188III TCNNGA 1 cut(s) 77
Hpy8I GTNNAC 1 cut(s) 256
HpyCH4III ACNGT 1 cut(s) 95
HpyCH4IV ACGT 1 cut(s) 52
HpyCH4V TGCA 2 cut(s) 132, 230
HpyF10VI GCNNNNNNNGC 1 cut(s) 227
HpyF3I CTNAG 3 cut(s) 66, 161, 234
HpySE526I ACGT 1 cut(s) 52
LpnPI CCDG 5 cut(s) 23, 70, 97, 127, 154
LweI GCATC 1 cut(s) 239
MaeI CTAG 2 cut(s) 77, 259
MaeII ACGT 1 cut(s) 52
MaeIII GTNAC 2 cut(s) 26, 101
MhlI GDGCHC 1 cut(s) 242
MmeI TCCRAC 1 cut(s) 114
MnlI CCTC 3 cut(s) 73, 115, 229
MseI TTAA 1 cut(s) 177
MspA1I CMGCKG 1 cut(s) 245
MspR9I CCNGG 1 cut(s) 85
MvaI CCWGG 1 cut(s) 85
MwoI GCNNNNNNNGC 1 cut(s) 227
NdeI CATATG 1 cut(s) 217
NmuCI GTSAC 2 cut(s) 26, 101
PceI AGGCCT 1 cut(s) 83
Psp6I CCWGG 1 cut(s) 83
PspGI CCWGG 1 cut(s) 83
PspPI GGNCC 2 cut(s) 87, 171
PstNI CAGNNNCTG 1 cut(s) 99
PvuII CAGCTG 1 cut(s) 245
SaqAI TTAA 1 cut(s) 177
Sau96I GGNCC 2 cut(s) 87, 171
ScrFI CCNGG 1 cut(s) 85
SduI GDGCHC 1 cut(s) 242
SetI ASST 4 cut(s) 55, 126, 157, 247
SfaNI GCATC 1 cut(s) 239
SgeI CNNG 7 cut(s) 34, 50, 89, 96, 97, 154, 181
SinI GGWCC 2 cut(s) 87, 171
SseBI AGGCCT 1 cut(s) 83
SspMI CTAG 2 cut(s) 77, 259
StuI AGGCCT 1 cut(s) 83
StyD4I CCNGG 1 cut(s) 83
TaaI ACNGT 1 cut(s) 95
TaiI ACGT 1 cut(s) 55
Tru1I TTAA 1 cut(s) 177
Tru9I TTAA 1 cut(s) 177
TscAI CASTG 1 cut(s) 100
TseFI GTSAC 2 cut(s) 26, 101
Tsp45I GTSAC 2 cut(s) 26, 101
TspRI CASTG 1 cut(s) 100
VpaK11BI GGWCC 2 cut(s) 87, 171
XbaI TCTAGA 1 cut(s) 76
XspI CTAG 2 cut(s) 77, 259
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.