Rmu_sc0001362.1_g000014

Pre-mRNA-splicing factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001362.1
Physical Location & Seq
Forward (+)
53017 .. 56690
3674 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001362.1_g000014.1.cds

Sequence Viewer

Length: 522 bp
atgggcagagccaaagccagaggagacccaaagctgaaggtgaagcagccctacttgggaaaaaaagagcctttgtgcagatatgttcgggtacttggtgcattttacttgcgtatcacaggcagcgatactgatgtctaccagtacctagagcctctgtacaatgactatcggaagttgagaagtaaattggctgatggacgtttctcgttgactcatgtggatgagcttattgatgaacttctgacaaaggactactcatgcgacattgccatgccacgaatcaagaaaagggctggtggagggttcaaagcccaggcccggccagcaacctggcttattaaagcccacctggcctggccttataagcccagctcggaagcccattcaattctagtatccgttgggcacgaggtagggctggtggagggttcaaagcccaagcccggccagcaacctggcttattaaagcccacctggcctggccttataagcccagctcggaagcccattcaattctag

Protein Analysis

173

Amino Acids

19.43

Weight (kDa)

9.85

Isoelectric Point (pI)

25.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 366, 491
AccI GTMKAC 1 cut(s) 138
AcoI YGGCCR 2 cut(s) 323, 448
AcuI CTGAAG 1 cut(s) 56
AfaI GTAC 3 cut(s) 93, 146, 161
AfiI CCNNNNNNNGG 3 cut(s) 56, 321, 446
AgsI TTSAA 4 cut(s) 310, 390, 435, 515
AjnI CCWGG 7 cut(s) 315, 332, 351, 356, 457, 476, 481
AluBI AGCT 4 cut(s) 34, 229, 375, 500
AluI AGCT 4 cut(s) 34, 229, 375, 500
Alw26I GTCTC 1 cut(s) 18
AoxI GGCC 7 cut(s) 318, 323, 354, 359, 448, 479, 484
ApeKI GCWGC 2 cut(s) 46, 123
AspS9I GGNCC 1 cut(s) 319
AsuC2I CCSGG 2 cut(s) 322, 447
AsuHPI GGTGA 1 cut(s) 52
BaeGI GKGCMC 1 cut(s) 411
BaeI ACNNNNGTAYC 4 cut(s) 97, 120, 130, 153
BarI GAAGNNNNNNTAC 2 cut(s) 35, 67
BauI CACGAG 1 cut(s) 410
BbvI GCAGC 2 cut(s) 58, 135
BccI CCATC 1 cut(s) 191
BciT130I CCWGG 7 cut(s) 317, 334, 353, 358, 459, 478, 483
BciVI GTATCC 1 cut(s) 409
BcnI CCSGG 2 cut(s) 322, 447
BcoDI GTCTC 1 cut(s) 18
BfaI CTAG 3 cut(s) 149, 395, 520
BfuI GTATCC 1 cut(s) 409
BglI GCCNNNNNGGC 2 cut(s) 353, 478
BisI GCNGC 2 cut(s) 47, 124
BlsI GCNGC 2 cut(s) 48, 125
Bme1390I CCNGG 9 cut(s) 317, 322, 334, 353, 358, 447, 459, 478, 483
BmgT120I GGNCC 1 cut(s) 319
BmrFI CCNGG 9 cut(s) 317, 322, 334, 353, 358, 447, 459, 478, 483
BpuMI CCSGG 2 cut(s) 322, 447
BsaI GGTCTC 1 cut(s) 18
BsaJI CCNNGG 1 cut(s) 315
Bsc4I CCNNNNNNNGG 3 cut(s) 56, 321, 446
Bse1I ACTGG 1 cut(s) 142
Bse3DI GCAATG 1 cut(s) 267
BseBI CCWGG 7 cut(s) 317, 334, 353, 358, 459, 478, 483
BseDI CCNNGG 1 cut(s) 315
BseGI GGATG 1 cut(s) 229
BseLI CCNNNNNNNGG 3 cut(s) 56, 321, 446
BseMI GCAATG 1 cut(s) 267
BseNI ACTGG 1 cut(s) 142
BseRI GAGGAG 1 cut(s) 36
BseSI GKGCMC 1 cut(s) 411
BseXI GCAGC 2 cut(s) 58, 135
BseYI CCCAGC 2 cut(s) 371, 496
BsgI GTGCAG 1 cut(s) 97
BshFI GGCC 7 cut(s) 320, 325, 356, 361, 450, 481, 486
BsiSI CCGG 2 cut(s) 322, 447
BslI CCNNNNNNNGG 3 cut(s) 56, 321, 446
BsmAI GTCTC 1 cut(s) 18
BsnI GGCC 7 cut(s) 320, 325, 356, 361, 450, 481, 486
Bso31I GGTCTC 1 cut(s) 18
Bsp1286I GDGCHC 1 cut(s) 411
Bsp1407I TGTACA 1 cut(s) 159
BspANI GGCC 7 cut(s) 320, 325, 356, 361, 450, 481, 486
BspTNI GGTCTC 1 cut(s) 18
BsrDI GCAATG 1 cut(s) 267
BsrGI TGTACA 1 cut(s) 159
BsrI ACTGG 1 cut(s) 142
BssECI CCNNGG 1 cut(s) 315
BssSI CACGAG 1 cut(s) 410
Bst2BI CACGAG 1 cut(s) 410
Bst2UI CCWGG 7 cut(s) 317, 334, 353, 358, 459, 478, 483
BstAUI TGTACA 1 cut(s) 159
BstC8I GCNNGC 2 cut(s) 327, 452
BstF5I GGATG 1 cut(s) 229
BstMAI GTCTC 1 cut(s) 18
BstMWI GCNNNNNNNGC 6 cut(s) 326, 353, 367, 451, 478, 492
BstNI CCWGG 7 cut(s) 317, 334, 353, 358, 459, 478, 483
BstSCI CCNGG 9 cut(s) 315, 320, 332, 351, 356, 445, 457, 476, 481
BstSLI GKGCMC 1 cut(s) 411
BstV1I GCAGC 2 cut(s) 58, 135
BstXI CCANNNNNNTGG 2 cut(s) 333, 458
BsuI GTATCC 1 cut(s) 409
BsuRI GGCC 7 cut(s) 320, 325, 356, 361, 450, 481, 486
BtsCI GGATG 1 cut(s) 229
Cac8I GCNNGC 2 cut(s) 327, 452
Cfr13I GGNCC 1 cut(s) 319
Csp6I GTAC 3 cut(s) 92, 145, 160
CviAII CATG 3 cut(s) 218, 261, 274
CviQI GTAC 3 cut(s) 92, 145, 160
EaeI YGGCCR 2 cut(s) 323, 448
Eco31I GGTCTC 1 cut(s) 18
Eco57I CTGAAG 1 cut(s) 56
EcoRII CCWGG 7 cut(s) 315, 332, 351, 356, 457, 476, 481
FaeI CATG 3 cut(s) 221, 264, 277
FaiI YATR 6 cut(s) 84, 219, 262, 275, 366, 491
FatI CATG 3 cut(s) 217, 260, 273
FblI GTMKAC 1 cut(s) 138
Fnu4HI GCNGC 2 cut(s) 47, 124
FokI GGATG 1 cut(s) 236
Fsp4HI GCNGC 2 cut(s) 47, 124
FspBI CTAG 3 cut(s) 149, 395, 520
GluI GCNGC 2 cut(s) 47, 124
GsaI CCCAGC 2 cut(s) 375, 500
HaeIII GGCC 7 cut(s) 320, 325, 356, 361, 450, 481, 486
HapII CCGG 2 cut(s) 322, 447
Hin1II CATG 3 cut(s) 221, 264, 277
HincII GTYRAC 1 cut(s) 213
HindII GTYRAC 1 cut(s) 213
HinfI GANTC 2 cut(s) 214, 282
HpaII CCGG 2 cut(s) 322, 447
HphI GGTGA 1 cut(s) 52
Hpy166II GTNNAC 2 cut(s) 139, 213
Hpy188I TCNGA 4 cut(s) 174, 246, 379, 504
Hpy188III TCNNGA 1 cut(s) 286
Hpy8I GTNNAC 2 cut(s) 139, 213
HpyAV CCTTC 1 cut(s) 31
HpyCH4IV ACGT 1 cut(s) 202
HpyCH4V TGCA 2 cut(s) 78, 101
HpyF10VI GCNNNNNNNGC 6 cut(s) 326, 353, 367, 451, 478, 492
HpySE526I ACGT 1 cut(s) 202
Hsp92II CATG 3 cut(s) 221, 264, 277
Lsp1109I GCAGC 2 cut(s) 58, 135
MaeI CTAG 3 cut(s) 149, 395, 520
MaeII ACGT 1 cut(s) 202
MhlI GDGCHC 1 cut(s) 411
MluCI AATT 3 cut(s) 188, 390, 515
MlyI GAGTC 1 cut(s) 208
MnlI CCTC 5 cut(s) 14, 165, 296, 406, 421
MseI TTAA 2 cut(s) 342, 467
MslI CAYNNNNRTG 2 cut(s) 222, 272
MspI CCGG 2 cut(s) 322, 447
MspR9I CCNGG 9 cut(s) 317, 322, 334, 353, 358, 447, 459, 478, 483
MvaI CCWGG 7 cut(s) 317, 334, 353, 358, 459, 478, 483
MwoI GCNNNNNNNGC 6 cut(s) 326, 353, 367, 451, 478, 492
NciI CCSGG 2 cut(s) 322, 447
NlaIII CATG 3 cut(s) 221, 264, 277
PfeI GAWTC 1 cut(s) 282
PkrI GCNGC 2 cut(s) 48, 125
PleI GAGTC 1 cut(s) 208
PpsI GAGTC 1 cut(s) 208
PsiI TTATAA 2 cut(s) 366, 491
Psp6I CCWGG 7 cut(s) 315, 332, 351, 356, 457, 476, 481
PspFI CCCAGC 2 cut(s) 371, 496
PspGI CCWGG 7 cut(s) 315, 332, 351, 356, 457, 476, 481
PspPI GGNCC 1 cut(s) 319
RsaI GTAC 3 cut(s) 93, 146, 161
RsaNI GTAC 3 cut(s) 92, 145, 160
RseI CAYNNNNRTG 2 cut(s) 222, 272
SaqAI TTAA 2 cut(s) 342, 467
SatI GCNGC 2 cut(s) 47, 124
Sau96I GGNCC 1 cut(s) 319
SchI GAGTC 1 cut(s) 208
ScrFI CCNGG 9 cut(s) 317, 322, 334, 353, 358, 447, 459, 478, 483
SduI GDGCHC 1 cut(s) 411
SmiMI CAYNNNNRTG 2 cut(s) 222, 272
Sse9I AATT 3 cut(s) 188, 390, 515
SspMI CTAG 3 cut(s) 149, 395, 520
StyD4I CCNGG 9 cut(s) 315, 320, 332, 351, 356, 445, 457, 476, 481
TaiI ACGT 1 cut(s) 205
TasI AATT 3 cut(s) 188, 390, 515
TatI WGTACW 1 cut(s) 159
TfiI GAWTC 1 cut(s) 282
Tru1I TTAA 2 cut(s) 342, 467
Tru9I TTAA 2 cut(s) 342, 467
TseI GCWGC 2 cut(s) 46, 123
TspDTI ATGAA 1 cut(s) 252
TspGWI ACGGA 1 cut(s) 391
XmiI GTMKAC 1 cut(s) 138
XspI CTAG 3 cut(s) 149, 395, 520
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.