Rmu_sc0010150.1_g000001

Auxin response factors (ARFs) are transcriptional factors that bind specifically to the DNA sequence 5'-TGTCTC-3' found in the auxin-responsive promoter elements (AuxREs)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010150.1
Physical Location & Seq
Forward (+)
2630 .. 3082
453 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010150.1_g000001.1.cds

Sequence Viewer

Length: 255 bp
atggaagagaagatgagaattggaggagggttgcttagtggagcacagtctagtatacttgaggagatgaagttgttaaaagaactgcaggatcattctgggtcccggaaggccataaattccgagttatggcatgcctgcgccggcccccttgtttgtttgcctcaagtggggagtcttgcttattacttccctcagggtcacagcgagcaggttagattcatcatcagttttgtctcagcagatgagtgttga

Protein Analysis

84

Amino Acids

9.22

Weight (kDa)

5.49

Isoelectric Point (pI)

70.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 202
AccI GTMKAC 1 cut(s) 55
AclWI GGATC 1 cut(s) 99
AcsI RAATTY 1 cut(s) 118
AfiI CCNNNNNNNGG 2 cut(s) 129, 170
Alw21I GWGCWC 1 cut(s) 46
Alw26I GTCTC 1 cut(s) 241
AlwI GGATC 1 cut(s) 99
AoxI GGCC 2 cut(s) 111, 145
ApoI RAATTY 1 cut(s) 118
AspLEI GCGC 1 cut(s) 143
AspS9I GGNCC 2 cut(s) 102, 146
AsuC2I CCSGG 1 cut(s) 106
AvaII GGWCC 1 cut(s) 102
AxyI CCTNAGG 1 cut(s) 195
Bbv12I GWGCWC 1 cut(s) 46
BcnI CCSGG 1 cut(s) 106
BcoDI GTCTC 1 cut(s) 241
BfaI CTAG 1 cut(s) 51
BfmI CTRYAG 1 cut(s) 86
BfuAI ACCTGC 1 cut(s) 202
Bme1390I CCNGG 1 cut(s) 106
Bme18I GGWCC 1 cut(s) 102
BmgT120I GGNCC 2 cut(s) 102, 146
BmiI GGNNCC 3 cut(s) 103, 104, 148
BmrFI CCNGG 1 cut(s) 106
BpuEI CTTGAG 2 cut(s) 80, 150
BpuMI CCSGG 1 cut(s) 106
BsaXI ACNNNNNCTCC 2 cut(s) 56, 86
Bsc4I CCNNNNNNNGG 2 cut(s) 129, 170
Bse118I RCCGGY 1 cut(s) 143
Bse21I CCTNAGG 1 cut(s) 195
BseLI CCNNNNNNNGG 2 cut(s) 129, 170
BseMII CTCAG 2 cut(s) 209, 252
BseRI GAGGAG 2 cut(s) 39, 77
BshFI GGCC 2 cut(s) 113, 147
BsiHKAI GWGCWC 1 cut(s) 46
BsiSI CCGG 2 cut(s) 106, 144
BslFI GGGAC 1 cut(s) 88
BslI CCNNNNNNNGG 2 cut(s) 129, 170
BsmAI GTCTC 1 cut(s) 241
BsmFI GGGAC 1 cut(s) 88
BsnI GGCC 2 cut(s) 113, 147
Bsp1286I GDGCHC 1 cut(s) 46
Bsp143I GATC 1 cut(s) 91
BspANI GGCC 2 cut(s) 113, 147
BspCNI CTCAG 2 cut(s) 208, 251
BspLI GGNNCC 3 cut(s) 103, 104, 148
BspMAI CTGCAG 1 cut(s) 90
BspMI ACCTGC 1 cut(s) 202
BspPI GGATC 1 cut(s) 99
BsrFI RCCGGY 1 cut(s) 143
BssAI RCCGGY 1 cut(s) 143
BssMI GATC 1 cut(s) 91
BssNAI GTATAC 1 cut(s) 56
Bst1107I GTATAC 1 cut(s) 56
Bst4CI ACNGT 1 cut(s) 48
BstC8I GCNNGC 4 cut(s) 135, 139, 145, 209
BstDEI CTNAG 3 cut(s) 35, 195, 238
BstHHI GCGC 1 cut(s) 143
BstKTI GATC 1 cut(s) 94
BstMAI GTCTC 1 cut(s) 241
BstMBI GATC 1 cut(s) 91
BstNSI RCATGY 1 cut(s) 137
BstSCI CCNGG 1 cut(s) 104
BstSFI CTRYAG 1 cut(s) 86
BstZ17I GTATAC 1 cut(s) 56
Bsu36I CCTNAGG 1 cut(s) 195
BsuRI GGCC 2 cut(s) 113, 147
BveI ACCTGC 1 cut(s) 202
Cac8I GCNNGC 4 cut(s) 135, 139, 145, 209
CfoI GCGC 1 cut(s) 143
Cfr10I RCCGGY 1 cut(s) 143
Cfr13I GGNCC 2 cut(s) 102, 146
CviAII CATG 1 cut(s) 134
CviJI RGCY 2 cut(s) 113, 147
CviKI_1 RGCY 2 cut(s) 113, 147
DdeI CTNAG 3 cut(s) 35, 195, 238
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
Eco47I GGWCC 1 cut(s) 102
Eco81I CCTNAGG 1 cut(s) 195
EcoO109I RGGNCCY 1 cut(s) 102
FaeI CATG 1 cut(s) 137
FaiI YATR 4 cut(s) 56, 116, 130, 135
FaqI GGGAC 1 cut(s) 88
FatI CATG 1 cut(s) 133
FblI GTMKAC 1 cut(s) 55
FspBI CTAG 1 cut(s) 51
GlaI GCGC 1 cut(s) 142
HaeIII GGCC 2 cut(s) 113, 147
HapII CCGG 2 cut(s) 106, 144
HhaI GCGC 1 cut(s) 143
Hin1II CATG 1 cut(s) 137
Hin6I GCGC 1 cut(s) 141
HinP1I GCGC 1 cut(s) 141
HinfI GANTC 2 cut(s) 175, 219
HpaII CCGG 2 cut(s) 106, 144
Hpy166II GTNNAC 1 cut(s) 56
Hpy188I TCNGA 1 cut(s) 124
Hpy8I GTNNAC 1 cut(s) 56
HpyAV CCTTC 1 cut(s) 103
HpyCH4III ACNGT 1 cut(s) 48
HpyCH4V TGCA 1 cut(s) 88
HpyF3I CTNAG 3 cut(s) 35, 195, 238
Hsp92II CATG 1 cut(s) 137
HspAI GCGC 1 cut(s) 141
KflI GGGWCCC 1 cut(s) 102
KroI GCCGGC 1 cut(s) 143
KroNI GCCGGC 1 cut(s) 145
Kzo9I GATC 1 cut(s) 91
LmnI GCTCC 1 cut(s) 41
LpnPI CCDG 7 cut(s) 74, 84, 119, 151, 157, 182, 197
MaeI CTAG 1 cut(s) 51
MaeIII GTNAC 1 cut(s) 200
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MboII GAAGA 2 cut(s) 17, 22
MhlI GDGCHC 1 cut(s) 46
MluCI AATT 2 cut(s) 18, 118
MlyI GAGTC 1 cut(s) 184
MnlI CCTC 5 cut(s) 17, 20, 55, 174, 204
MroNI GCCGGC 1 cut(s) 143
MseI TTAA 1 cut(s) 77
MspI CCGG 2 cut(s) 106, 144
MspR9I CCNGG 1 cut(s) 106
NaeI GCCGGC 1 cut(s) 145
NciI CCSGG 1 cut(s) 106
NdeII GATC 1 cut(s) 91
NgoMIV GCCGGC 1 cut(s) 143
NlaIII CATG 1 cut(s) 137
NlaIV GGNNCC 3 cut(s) 103, 104, 148
NmuCI GTSAC 1 cut(s) 200
NspI RCATGY 1 cut(s) 137
PaeI GCATGC 1 cut(s) 137
PdiI GCCGGC 1 cut(s) 145
PfeI GAWTC 1 cut(s) 219
PfoI TCCNGGA 1 cut(s) 104
PleI GAGTC 1 cut(s) 183
PpsI GAGTC 1 cut(s) 183
PpuMI RGGWCCY 1 cut(s) 102
Psp5II RGGWCCY 1 cut(s) 102
PspN4I GGNNCC 3 cut(s) 103, 104, 148
PspPI GGNCC 2 cut(s) 102, 146
PspPPI RGGWCCY 1 cut(s) 102
PstI CTGCAG 1 cut(s) 90
SaqAI TTAA 1 cut(s) 77
Sau3AI GATC 1 cut(s) 91
Sau96I GGNCC 2 cut(s) 102, 146
SchI GAGTC 1 cut(s) 184
ScrFI CCNGG 1 cut(s) 106
SduI GDGCHC 1 cut(s) 46
SetI ASST 1 cut(s) 216
SfcI CTRYAG 1 cut(s) 86
SinI GGWCC 1 cut(s) 102
SmlI CTYRAG 2 cut(s) 59, 165
SmoI CTYRAG 2 cut(s) 59, 165
SphI GCATGC 1 cut(s) 137
Sse9I AATT 2 cut(s) 18, 118
SspMI CTAG 1 cut(s) 51
StyD4I CCNGG 1 cut(s) 104
TaaI ACNGT 1 cut(s) 48
TasI AATT 2 cut(s) 18, 118
TfiI GAWTC 1 cut(s) 219
Tru1I TTAA 1 cut(s) 77
Tru9I TTAA 1 cut(s) 77
TseFI GTSAC 1 cut(s) 200
Tsp45I GTSAC 1 cut(s) 200
TspDTI ATGAA 2 cut(s) 83, 211
VpaK11BI GGWCC 1 cut(s) 102
XapI RAATTY 1 cut(s) 118
XceI RCATGY 1 cut(s) 137
XmiI GTMKAC 1 cut(s) 55
XspI CTAG 1 cut(s) 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.