RchiOBHm_Chr6g0248711

HAUS augmin-like complex subunit 6 N-terminus

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
4645783 .. 4646151
369 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22293

Sequence Viewer

Length: 180 bp
ATGATCTTGCAGGATTTCGATAAGGTCTGGCCAATCTTCGATTCTACGCAATCTCGCGATTTTCGTAAGGTTGTGCAAGGGATTTTTAGCGAGCTCGAATCGCAAGGGGCGCTTCCCAGGAGCAATTCGAGGGTTTCATCACTTGCTACATGTTGTGGACCGAGTTCATTCGGTTTTTGA

Protein Analysis

59

Amino Acids

6.57

Weight (kDa)

6.02

Isoelectric Point (pI)

61.3

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HAUS6_N PF14661 4 - 53 6.7e-11 HAUS augmin-like complex subunit 6 N-terminus
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 57
AcoI YGGCCR 1 cut(s) 29
AflIII ACRYGT 1 cut(s) 149
AjnI CCWGG 1 cut(s) 116
AjuI GAANNNNNNNTTGG 2 cut(s) 25, 57
AluBI AGCT 1 cut(s) 94
AluI AGCT 1 cut(s) 94
Alw21I GWGCWC 1 cut(s) 96
AoxI GGCC 1 cut(s) 29
AspLEI GCGC 1 cut(s) 112
AspS9I GGNCC 1 cut(s) 158
AvaII GGWCC 1 cut(s) 158
BalI TGGCCA 1 cut(s) 31
BanII GRGCYC 1 cut(s) 96
Bbv12I GWGCWC 1 cut(s) 96
BciT130I CCWGG 1 cut(s) 118
BfoI RGCGCY 1 cut(s) 113
Bme1390I CCNGG 1 cut(s) 118
Bme18I GGWCC 1 cut(s) 158
BmgT120I GGNCC 1 cut(s) 158
BmrFI CCNGG 1 cut(s) 118
BsaJI CCNNGG 1 cut(s) 116
BseBI CCWGG 1 cut(s) 118
BseDI CCNNGG 1 cut(s) 116
Bsh1236I CGCG 1 cut(s) 57
BshFI GGCC 1 cut(s) 31
BsiHKAI GWGCWC 1 cut(s) 96
BsnI GGCC 1 cut(s) 31
Bsp1286I GDGCHC 1 cut(s) 96
Bsp143I GATC 1 cut(s) 3
Bsp68I TCGCGA 1 cut(s) 57
BspANI GGCC 1 cut(s) 31
BspFNI CGCG 1 cut(s) 57
BssECI CCNNGG 1 cut(s) 116
BssMI GATC 1 cut(s) 3
Bst2UI CCWGG 1 cut(s) 118
BstC8I GCNNGC 1 cut(s) 92
BstFNI CGCG 1 cut(s) 57
BstH2I RGCGCY 1 cut(s) 113
BstHHI GCGC 1 cut(s) 112
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BstMWI GCNNNNNNNGC 2 cut(s) 100, 109
BstNI CCWGG 1 cut(s) 118
BstNSI RCATGY 1 cut(s) 153
BstSCI CCNGG 1 cut(s) 116
BstUI CGCG 1 cut(s) 57
BsuRI GGCC 1 cut(s) 31
BtuMI TCGCGA 1 cut(s) 57
Cac8I GCNNGC 1 cut(s) 92
CfoI GCGC 1 cut(s) 112
Cfr13I GGNCC 1 cut(s) 158
CviAII CATG 1 cut(s) 150
CviJI RGCY 2 cut(s) 31, 94
CviKI_1 RGCY 2 cut(s) 31, 94
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
EaeI YGGCCR 1 cut(s) 29
Ecl136II GAGCTC 1 cut(s) 94
Eco24I GRGCYC 1 cut(s) 96
Eco47I GGWCC 1 cut(s) 158
Eco53kI GAGCTC 1 cut(s) 94
EcoICRI GAGCTC 1 cut(s) 94
EcoRII CCWGG 1 cut(s) 116
EcoT38I GRGCYC 1 cut(s) 96
FaeI CATG 1 cut(s) 153
FaiI YATR 1 cut(s) 151
FalI AAGNNNNNCTT 2 cut(s) 96, 128
FatI CATG 1 cut(s) 149
FriOI GRGCYC 1 cut(s) 96
GlaI GCGC 1 cut(s) 111
HaeII RGCGCY 1 cut(s) 113
HaeIII GGCC 1 cut(s) 31
HhaI GCGC 1 cut(s) 112
Hin1II CATG 1 cut(s) 153
Hin6I GCGC 1 cut(s) 110
HinP1I GCGC 1 cut(s) 110
HinfI GANTC 2 cut(s) 41, 98
Hpy166II GTNNAC 1 cut(s) 158
Hpy188III TCNNGA 1 cut(s) 56
Hpy8I GTNNAC 1 cut(s) 158
HpyCH4V TGCA 2 cut(s) 10, 76
HpyF10VI GCNNNNNNNGC 2 cut(s) 100, 109
Hsp92II CATG 1 cut(s) 153
HspAI GCGC 1 cut(s) 110
Kzo9I GATC 1 cut(s) 3
LmnI GCTCC 1 cut(s) 120
LpnPI CCDG 3 cut(s) 13, 103, 130
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MboII GAAGA 1 cut(s) 28
MhlI GDGCHC 1 cut(s) 96
MlsI TGGCCA 1 cut(s) 31
MluCI AATT 1 cut(s) 124
MluNI TGGCCA 1 cut(s) 31
MnlI CCTC 1 cut(s) 123
Mox20I TGGCCA 1 cut(s) 31
MscI TGGCCA 1 cut(s) 31
Msp20I TGGCCA 1 cut(s) 31
MspR9I CCNGG 1 cut(s) 118
MvaI CCWGG 1 cut(s) 118
MvnI CGCG 1 cut(s) 57
MwoI GCNNNNNNNGC 2 cut(s) 100, 109
NdeII GATC 1 cut(s) 3
NlaIII CATG 1 cut(s) 153
NruI TCGCGA 1 cut(s) 57
NspI RCATGY 1 cut(s) 153
PciI ACATGT 1 cut(s) 149
PcsI WCGNNNNNNNCGW 1 cut(s) 61
PfeI GAWTC 2 cut(s) 41, 98
PscI ACATGT 1 cut(s) 149
Psp124BI GAGCTC 1 cut(s) 96
Psp6I CCWGG 1 cut(s) 116
PspGI CCWGG 1 cut(s) 116
PspPI GGNCC 1 cut(s) 158
RruI TCGCGA 1 cut(s) 57
SacI GAGCTC 1 cut(s) 96
Sau3AI GATC 1 cut(s) 3
Sau96I GGNCC 1 cut(s) 158
ScrFI CCNGG 1 cut(s) 118
SduI GDGCHC 1 cut(s) 96
SetI ASST 3 cut(s) 27, 72, 96
SinI GGWCC 1 cut(s) 158
Sse9I AATT 1 cut(s) 124
SstI GAGCTC 1 cut(s) 96
StyD4I CCNGG 1 cut(s) 116
TaqI TCGA 4 cut(s) 18, 39, 96, 128
TaqII GACCGA 1 cut(s) 175
TasI AATT 1 cut(s) 124
TfiI GAWTC 2 cut(s) 41, 98
TspDTI ATGAA 2 cut(s) 126, 156
VpaK11BI GGWCC 1 cut(s) 158
XceI RCATGY 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.