Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0010605

Physical Location & Seq

Genomic Coordinates Reverse (-)

11581266 .. 11582100

Gene Structure 835 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ23000

Sequence Viewer

CDS Protein Promoter (2k)

Length: 180 bp

ATGAACATAGGAACCATCACCAAATTGTTCGGAGCAGGAGAGAATGAGTGTTCAATAATCCTGCTGTGGACTAATGTATTTGCTTTAGTATCACCTACTTTATGGTCAGCCTTCTTCATGTGGTTTGTAGCCAGGCAAGTGTGGAACAGCTACAAAGGTTCCAGGTTCAACCACATATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005215 GO:0005575 GO:0006810 GO:0008150 GO:0016020 GO:0016021 GO:0022857 GO:0031224 GO:0044425 GO:0051179 GO:0051234 GO:0055085

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Mem_trans

Protein Analysis

59

Amino Acids

6.81

Weight (kDa)

9.19

Isoelectric Point (pI)

46.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010605)

Species	Orthologous Gene IDs
malus_domestica	MD05G1225700.v1.1 MD05G1225900.v1.1
rosa_chinensis	RchiOBHm_Chr1g0350291 RchiOBHm_Chr3g0465941 RchiOBHm_Chr6g0256401 RchiOBHm_Chr7g0217151 RchiOBHm_Chr7g0219351
rosa_laevigata	RLG00000009798 RLG00000014784 RLG00000017295 RLG00000024613
rosa_roxburghii	Rroxscaffold_5G00337830 Rroxscaffold_6G00414880 Rroxscaffold_7G00190630
rosa_rugosa	Rorug01G0468500
rosa_samantha	Rh3BG145700 Rh3CG146800 Rh3DG235900 Rh6AG082200 Rh7AG228100 Rh7CG242600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	2 cut(s)	54, 169
AjnI	CCWGG	2 cut(s)	131, 161
AluBI	AGCT	1 cut(s)	150
AluI	AGCT	1 cut(s)	150
AsuHPI	GGTGA	2 cut(s)	10, 84
BccI	CCATC	1 cut(s)	23
BciT130I	CCWGG	2 cut(s)	133, 163
Bme1390I	CCNGG	2 cut(s)	133, 163
BmiI	GGNNCC	2 cut(s)	13, 160
BmrFI	CCNGG	2 cut(s)	133, 163
BseBI	CCWGG	2 cut(s)	133, 163
BspLI	GGNNCC	2 cut(s)	13, 160
Bst2UI	CCWGG	2 cut(s)	133, 163
BstNI	CCWGG	2 cut(s)	133, 163
BstSCI	CCNGG	2 cut(s)	131, 161
CviAII	CATG	1 cut(s)	118
CviJI	RGCY	3 cut(s)	110, 131, 150
CviKI_1	RGCY	3 cut(s)	110, 131, 150
EcoRII	CCWGG	2 cut(s)	131, 161
FaeI	CATG	1 cut(s)	121
FaiI	YATR	5 cut(s)	8, 103, 119, 176, 178
FatI	CATG	1 cut(s)	117
Hin1II	CATG	1 cut(s)	121
HphI	GGTGA	2 cut(s)	10, 84
Hpy166II	GTNNAC	1 cut(s)	69
Hpy188I	TCNGA	1 cut(s)	32
Hpy8I	GTNNAC	1 cut(s)	69
HpyAV	CCTTC	1 cut(s)	121
Hsp92II	CATG	1 cut(s)	121
LmnI	GCTCC	1 cut(s)	32
LpnPI	CCDG	6 cut(s)	21, 74, 118, 145, 148, 175
MboII	GAAGA	1 cut(s)	106
MluCI	AATT	1 cut(s)	23
MspR9I	CCNGG	2 cut(s)	133, 163
MvaI	CCWGG	2 cut(s)	133, 163
NlaIII	CATG	1 cut(s)	121
NlaIV	GGNNCC	2 cut(s)	13, 160
Psp6I	CCWGG	2 cut(s)	131, 161
PspGI	CCWGG	2 cut(s)	131, 161
PspN4I	GGNNCC	2 cut(s)	13, 160
ScrFI	CCNGG	2 cut(s)	133, 163
SetI	ASST	4 cut(s)	97, 152, 160, 167
SgeI	CNNG	8 cut(s)	48, 73, 130, 144, 145, 149, 174, 175
Sse9I	AATT	1 cut(s)	23
StyD4I	CCNGG	2 cut(s)	131, 161
TasI	AATT	1 cut(s)	23
TspDTI	ATGAA	2 cut(s)	17, 106

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.