Rroxscaffold_7G00190630

Encoded by

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
30847500 .. 30849094
1595 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00190630.1

Sequence Viewer

Length: 177 bp
ATGAACATAGGAATCATCACACAATTGTTTGGAGCAAGAGAGAATGAGTGTTCAATAATCCTGCTGTGGTATTTGCTTCAGTATCACTTACTTTATGATCTGCCTTCTTCATGTGGTTTGTGGCTAGGCAAGCGTGAAACGGCTACAAAGGTGCAATTCATATATATAGGCACTTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

58

Amino Acids

6.71

Weight (kDa)

6.52

Isoelectric Point (pI)

60.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 62
AgsI TTSAA 1 cut(s) 54
BceAI ACGGC 1 cut(s) 156
BfaI CTAG 1 cut(s) 125
Bsp143I GATC 1 cut(s) 97
BssMI GATC 1 cut(s) 97
BstC8I GCNNGC 1 cut(s) 131
BstKTI GATC 1 cut(s) 100
BstMBI GATC 1 cut(s) 97
BstMWI GCNNNNNNNGC 1 cut(s) 130
Cac8I GCNNGC 1 cut(s) 131
CviAII CATG 1 cut(s) 111
CviJI RGCY 2 cut(s) 124, 143
CviKI_1 RGCY 2 cut(s) 124, 143
DpnI GATC 1 cut(s) 99
DpnII GATC 1 cut(s) 97
Eco57I CTGAAG 1 cut(s) 62
FaeI CATG 1 cut(s) 114
FaiI YATR 7 cut(s) 8, 96, 112, 161, 163, 165, 167
FatI CATG 1 cut(s) 110
FspBI CTAG 1 cut(s) 125
Hin1II CATG 1 cut(s) 114
HinfI GANTC 1 cut(s) 12
HpyAV CCTTC 1 cut(s) 114
HpyCH4V TGCA 1 cut(s) 154
HpyF10VI GCNNNNNNNGC 1 cut(s) 130
Hsp92II CATG 1 cut(s) 114
Kzo9I GATC 1 cut(s) 97
LmnI GCTCC 1 cut(s) 32
LpnPI CCDG 1 cut(s) 74
MaeI CTAG 1 cut(s) 125
MalI GATC 1 cut(s) 99
MboI GATC 1 cut(s) 97
MboII GAAGA 1 cut(s) 99
MfeI CAATTG 1 cut(s) 23
MluCI AATT 2 cut(s) 23, 155
MseI TTAA 1 cut(s) 175
MunI CAATTG 1 cut(s) 23
MwoI GCNNNNNNNGC 1 cut(s) 130
NdeII GATC 1 cut(s) 97
NlaIII CATG 1 cut(s) 114
PfeI GAWTC 1 cut(s) 12
SaqAI TTAA 1 cut(s) 175
Sau3AI GATC 1 cut(s) 97
SetI ASST 1 cut(s) 153
SgeI CNNG 6 cut(s) 48, 73, 123, 137, 142, 146
Sse9I AATT 2 cut(s) 23, 155
SspMI CTAG 1 cut(s) 125
TasI AATT 2 cut(s) 23, 155
TfiI GAWTC 1 cut(s) 12
Tru1I TTAA 1 cut(s) 175
Tru9I TTAA 1 cut(s) 175
TspDTI ATGAA 3 cut(s) 17, 99, 148
XspI CTAG 1 cut(s) 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.