Rh7CG242600

Encoded by

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
22654461 .. 22658558
4098 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG242600.1

Sequence Viewer

Length: 264 bp
ATGAAGATAAATTCTTTCAAGTTGACAGAAAATAAATTGAAAAGATGTCAAATCATCTCAAATTATTCCAAATCAAAAGATGGAGCTATCCCCGGTCTCACTTTGACAATTGAAGGAAACCTCCCTAAAGGAACTATCACCCAATCATTTGGAGCAGGAGAGAATGAGTGTTCAATAATCCTGCTGTGGACTAATGTATTTGCTTCGGTATCACTTACTCTATGGTCTGCCTTCTTCATGCCGTTTGTGGCCAGGCCAGTGTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

9.59

Weight (kDa)

9.39

Isoelectric Point (pI)

38.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 249
AcsI RAATTY 1 cut(s) 10
AgsI TTSAA 4 cut(s) 19, 40, 113, 174
AjnI CCWGG 1 cut(s) 251
AluBI AGCT 1 cut(s) 86
AluI AGCT 1 cut(s) 86
Alw26I GTCTC 1 cut(s) 101
AoxI GGCC 2 cut(s) 249, 254
ApoI RAATTY 1 cut(s) 10
AsuC2I CCSGG 1 cut(s) 93
AsuHPI GGTGA 1 cut(s) 130
BalI TGGCCA 1 cut(s) 251
BccI CCATC 1 cut(s) 74
BceAI ACGGC 1 cut(s) 226
BciT130I CCWGG 1 cut(s) 253
BcnI CCSGG 1 cut(s) 93
BcoDI GTCTC 1 cut(s) 101
Bme1390I CCNGG 2 cut(s) 93, 253
BmrFI CCNGG 2 cut(s) 93, 253
BpuMI CCSGG 1 cut(s) 93
BsaI GGTCTC 1 cut(s) 101
BsaJI CCNNGG 1 cut(s) 91
Bse1I ACTGG 1 cut(s) 257
BseBI CCWGG 1 cut(s) 253
BseDI CCNNGG 1 cut(s) 91
BseNI ACTGG 1 cut(s) 257
BshFI GGCC 2 cut(s) 251, 256
BsiSI CCGG 1 cut(s) 93
BsmAI GTCTC 1 cut(s) 101
BsnI GGCC 2 cut(s) 251, 256
Bso31I GGTCTC 1 cut(s) 101
BspANI GGCC 2 cut(s) 251, 256
BspTNI GGTCTC 1 cut(s) 101
BsrI ACTGG 1 cut(s) 257
BssECI CCNNGG 1 cut(s) 91
Bst2UI CCWGG 1 cut(s) 253
BstMAI GTCTC 1 cut(s) 101
BstNI CCWGG 1 cut(s) 253
BstSCI CCNGG 2 cut(s) 91, 251
BstXI CCANNNNNNTGG 1 cut(s) 149
BsuRI GGCC 2 cut(s) 251, 256
BtsIMutI CAGTG 1 cut(s) 264
CviAII CATG 1 cut(s) 238
CviJI RGCY 3 cut(s) 86, 251, 256
CviKI_1 RGCY 3 cut(s) 86, 251, 256
EaeI YGGCCR 1 cut(s) 249
Eco31I GGTCTC 1 cut(s) 101
EcoRII CCWGG 1 cut(s) 251
FaeI CATG 1 cut(s) 241
FaiI YATR 2 cut(s) 223, 239
FatI CATG 1 cut(s) 237
HaeIII GGCC 2 cut(s) 251, 256
HapII CCGG 1 cut(s) 93
Hin1II CATG 1 cut(s) 241
HincII GTYRAC 1 cut(s) 24
HindII GTYRAC 1 cut(s) 24
HpaII CCGG 1 cut(s) 93
HphI GGTGA 1 cut(s) 130
Hpy166II GTNNAC 2 cut(s) 24, 189
Hpy8I GTNNAC 2 cut(s) 24, 189
HpyAV CCTTC 2 cut(s) 107, 241
Hsp92II CATG 1 cut(s) 241
LmnI GCTCC 2 cut(s) 83, 152
LpnPI CCDG 4 cut(s) 106, 141, 194, 238
MboII GAAGA 2 cut(s) 16, 226
MfeI CAATTG 1 cut(s) 108
MlsI TGGCCA 1 cut(s) 251
MluCI AATT 4 cut(s) 10, 35, 61, 108
MluNI TGGCCA 1 cut(s) 251
MnlI CCTC 1 cut(s) 131
Mox20I TGGCCA 1 cut(s) 251
MscI TGGCCA 1 cut(s) 251
Msp20I TGGCCA 1 cut(s) 251
MspI CCGG 1 cut(s) 93
MspR9I CCNGG 2 cut(s) 93, 253
MunI CAATTG 1 cut(s) 108
MvaI CCWGG 1 cut(s) 253
NciI CCSGG 1 cut(s) 93
NlaIII CATG 1 cut(s) 241
Psp6I CCWGG 1 cut(s) 251
PspGI CCWGG 1 cut(s) 251
ScrFI CCNGG 2 cut(s) 93, 253
SetI ASST 2 cut(s) 88, 123
SgeI CNNG 6 cut(s) 31, 104, 105, 168, 193, 250
Sse9I AATT 4 cut(s) 10, 35, 61, 108
StyD4I CCNGG 2 cut(s) 91, 251
TasI AATT 4 cut(s) 10, 35, 61, 108
TscAI CASTG 1 cut(s) 264
TspDTI ATGAA 2 cut(s) 17, 226
TspRI CASTG 1 cut(s) 264
XapI RAATTY 1 cut(s) 10
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.