RchiOBHm_Chr6g0294431

Pollen proteins Ole e I like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0008322
Physical Location & Seq
Reverse (-)
56752950 .. 56754121
1172 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ26425

Sequence Viewer

Length: 933 bp
ATGGCTCTCACTCACTTCCTCCTCCCCACCTGTCTGGTTTTACTTTCATTGCTACTCATCAACGTCTCAGCTACTGATTATGGCTATGGCCCAAAACCACCACAGGTTGAGCAACCAAAACCTCCACAGGTCCAGAAACCAGAACCACCACAGCTCGAGAAACCAAAACCACCACATGTTGAGAAACCAACACCTCCACAGGTCTCTGCTACTGATTATGGCTATGGCCCAAAACCACCACAGGTTGAGCAACCAAAACCTCCGCAGGTCCAGAAACCAATAAAACCACCACAGGTTGAGAAACCAACACCTCCACAGGTCTCTGCTACTGATTATGGCTATGGCCCAAAACCACCACAGGTTGAGCAACCAAAACCTCCGCAGGTCCAGAAACCAATAAAACCACCACAGGTTGAGAAACCAACACCTCCACAAGTCTCTACTAATGATTATGGCCATGGCCCAAAACCACAGGTTGAGAAACCAAAATTAGATCAGTTGTACGGAGAGCTACTACCTCACAATCTATTCGGCATTCAAGGGCTTGTTTTATGTAACTCAGGACTTAAAGCCTTCCCAATTCAAGGAGCTGTGGCAAGGATTACATGCGTGGGCGAGGACGAAAATGGGTACGAGACTGCACCTTTCTCCATCTTAAGTGGTGCAACTGATGCAATGGGTTACTTCTTTGCAACATTGTCACCTTCAAAGCTTGAAGGTAATTACAACAATAAGTGGAAGCTCACAGAGTGCAAGACATTCCTCGACAATTCTCCACTGGAGAGCTGCAAAGTCCCTACTGATGTCAACCATGGAATTAGTGGGGCTCTGATTGCTTCTTATCGCACTCTCAATGCCAAGAACATGAAGCTGTTCTCTGTTGGACCCTTCTTCTACTCCTCAGAACCTAAACCAGCCCCTAGTGGCTATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pollen_Ole_e_I

Protein Analysis

310

Amino Acids

33.79

Weight (kDa)

8.6

Isoelectric Point (pI)

32.27

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pollen_Ole_e_1 PF01190 179 - 275 8.9e-17 Pollen protein Ole e 1 like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 256, 373
AciI CCGC 2 cut(s) 263, 380
AcoI YGGCCR 1 cut(s) 454
AdeI CACNNNGTG 1 cut(s) 750
AfaI GTAC 2 cut(s) 503, 632
AfiI CCNNNNNNNGG 1 cut(s) 584
AflII CTTAAG 1 cut(s) 655
AflIII ACRYGT 1 cut(s) 175
AgsI TTSAA 4 cut(s) 539, 584, 708, 716
AluBI AGCT 8 cut(s) 71, 154, 511, 590, 712, 742, 786, 871
AluI AGCT 8 cut(s) 71, 154, 511, 590, 712, 742, 786, 871
Alw26I GTCTC 5 cut(s) 70, 208, 325, 442, 629
AlwNI CAGNNNCTG 1 cut(s) 74
Ama87I CYCGRG 1 cut(s) 155
AoxI GGCC 5 cut(s) 88, 226, 343, 454, 460
ApeKI GCWGC 1 cut(s) 786
Asp700I GAANNNNTTC 1 cut(s) 872
AspS9I GGNCC 8 cut(s) 89, 130, 227, 268, 344, 385, 461, 884
AsuHPI GGTGA 1 cut(s) 693
AvaI CYCGRG 1 cut(s) 155
AvaII GGWCC 4 cut(s) 130, 268, 385, 884
BalI TGGCCA 1 cut(s) 456
BanII GRGCYC 1 cut(s) 829
BbvI GCAGC 1 cut(s) 773
BccI CCATC 1 cut(s) 659
BcoDI GTCTC 5 cut(s) 70, 208, 325, 442, 629
BfaI CTAG 1 cut(s) 921
BfrI CTTAAG 1 cut(s) 655
BfuAI ACCTGC 2 cut(s) 256, 373
BisI GCNGC 1 cut(s) 787
BlsI GCNGC 1 cut(s) 788
Bme18I GGWCC 4 cut(s) 130, 268, 385, 884
BmeT110I CYCGRG 1 cut(s) 155
BmgT120I GGNCC 8 cut(s) 89, 130, 227, 268, 344, 385, 461, 884
BmiI GGNNCC 1 cut(s) 886
BmsI GCATC 1 cut(s) 661
BpmI CTGGAG 1 cut(s) 800
BsaI GGTCTC 2 cut(s) 208, 325
BsaJI CCNNGG 2 cut(s) 457, 811
Bsc4I CCNNNNNNNGG 1 cut(s) 584
Bse1I ACTGG 1 cut(s) 783
Bse3DI GCAATG 2 cut(s) 47, 681
BseDI CCNNGG 2 cut(s) 457, 811
BseLI CCNNNNNNNGG 1 cut(s) 584
BseMI GCAATG 2 cut(s) 47, 681
BseMII CTCAG 3 cut(s) 81, 573, 915
BseNI ACTGG 1 cut(s) 783
BseRI GAGGAG 2 cut(s) 11, 889
BseXI GCAGC 1 cut(s) 773
BsgI GTGCAG 1 cut(s) 624
BshFI GGCC 5 cut(s) 90, 228, 345, 456, 462
BsiHKCI CYCGRG 1 cut(s) 155
BslFI GGGAC 1 cut(s) 779
BslI CCNNNNNNNGG 1 cut(s) 584
BsmAI GTCTC 5 cut(s) 70, 208, 325, 442, 629
BsmBI CGTCTC 1 cut(s) 70
BsmFI GGGAC 1 cut(s) 779
BsmI GAATGC 1 cut(s) 534
BsnI GGCC 5 cut(s) 90, 228, 345, 456, 462
Bso31I GGTCTC 2 cut(s) 208, 325
BsoBI CYCGRG 1 cut(s) 155
Bsp1286I GDGCHC 1 cut(s) 829
Bsp143I GATC 1 cut(s) 493
Bsp19I CCATGG 2 cut(s) 457, 811
BspACI CCGC 2 cut(s) 263, 380
BspANI GGCC 5 cut(s) 90, 228, 345, 456, 462
BspCNI CTCAG 3 cut(s) 80, 572, 914
BspLI GGNNCC 1 cut(s) 886
BspMI ACCTGC 2 cut(s) 256, 373
BspTI CTTAAG 1 cut(s) 655
BspTNI GGTCTC 2 cut(s) 208, 325
BsrDI GCAATG 2 cut(s) 47, 681
BsrI ACTGG 1 cut(s) 783
BssECI CCNNGG 2 cut(s) 457, 811
BssMI GATC 1 cut(s) 493
BssT1I CCWWGG 2 cut(s) 457, 811
BstAFI CTTAAG 1 cut(s) 655
BstAPI GCANNNNNTGC 1 cut(s) 671
BstDEI CTNAG 3 cut(s) 67, 559, 901
BstDSI CCRYGG 2 cut(s) 457, 811
BstKTI GATC 1 cut(s) 496
BstMAI GTCTC 5 cut(s) 70, 208, 325, 442, 629
BstMBI GATC 1 cut(s) 493
BstMWI GCNNNNNNNGC 2 cut(s) 671, 833
BstNSI RCATGY 2 cut(s) 179, 609
BstV1I GCAGC 1 cut(s) 773
BstXI CCANNNNNNTGG 1 cut(s) 34
BsuRI GGCC 5 cut(s) 90, 228, 345, 456, 462
BtgI CCRYGG 2 cut(s) 457, 811
BtsIMutI CAGTG 1 cut(s) 776
BveI ACCTGC 2 cut(s) 256, 373
CaiI CAGNNNCTG 1 cut(s) 74
Cfr13I GGNCC 8 cut(s) 89, 130, 227, 268, 344, 385, 461, 884
Csp6I GTAC 2 cut(s) 502, 631
CviAII CATG 5 cut(s) 176, 458, 606, 812, 865
CviQI GTAC 2 cut(s) 502, 631
DdeI CTNAG 3 cut(s) 67, 559, 901
DpnI GATC 1 cut(s) 495
DpnII GATC 1 cut(s) 493
DraIII CACNNNGTG 1 cut(s) 750
EaeI YGGCCR 1 cut(s) 454
Eco130I CCWWGG 2 cut(s) 457, 811
Eco24I GRGCYC 1 cut(s) 829
Eco31I GGTCTC 2 cut(s) 208, 325
Eco47I GGWCC 4 cut(s) 130, 268, 385, 884
Eco88I CYCGRG 1 cut(s) 155
EcoT14I CCWWGG 2 cut(s) 457, 811
EcoT38I GRGCYC 1 cut(s) 829
ErhI CCWWGG 2 cut(s) 457, 811
Esp3I CGTCTC 1 cut(s) 70
FaeI CATG 5 cut(s) 179, 461, 609, 815, 868
FaqI GGGAC 1 cut(s) 779
FatI CATG 5 cut(s) 175, 457, 605, 811, 864
Fnu4HI GCNGC 1 cut(s) 787
FriOI GRGCYC 1 cut(s) 829
Fsp4HI GCNGC 1 cut(s) 787
FspBI CTAG 1 cut(s) 921
GluI GCNGC 1 cut(s) 787
GsuI CTGGAG 1 cut(s) 800
HaeIII GGCC 5 cut(s) 90, 228, 345, 456, 462
Hin1II CATG 5 cut(s) 179, 461, 609, 815, 868
HincII GTYRAC 1 cut(s) 808
HindII GTYRAC 1 cut(s) 808
HindIII AAGCTT 1 cut(s) 710
HphI GGTGA 1 cut(s) 693
Hpy166II GTNNAC 1 cut(s) 808
Hpy188I TCNGA 2 cut(s) 831, 904
Hpy188III TCNNGA 5 cut(s) 133, 157, 271, 388, 561
Hpy8I GTNNAC 1 cut(s) 808
HpyAV CCTTC 4 cut(s) 583, 710, 714, 898
HpyCH4IV ACGT 1 cut(s) 63
HpyCH4V TGCA 6 cut(s) 641, 665, 674, 692, 753, 789
HpyF10VI GCNNNNNNNGC 2 cut(s) 671, 833
HpyF3I CTNAG 3 cut(s) 67, 559, 901
HpySE526I ACGT 1 cut(s) 63
Hsp92II CATG 5 cut(s) 179, 461, 609, 815, 868
Kzo9I GATC 1 cut(s) 493
LmnI GCTCC 1 cut(s) 587
Lsp1109I GCAGC 1 cut(s) 773
LweI GCATC 1 cut(s) 661
MaeI CTAG 1 cut(s) 921
MaeII ACGT 1 cut(s) 63
MaeIII GTNAC 3 cut(s) 554, 680, 699
MalI GATC 1 cut(s) 495
MboI GATC 1 cut(s) 493
MboII GAAGA 1 cut(s) 883
MhlI GDGCHC 1 cut(s) 829
MlsI TGGCCA 1 cut(s) 456
MluCI AATT 5 cut(s) 488, 579, 721, 769, 816
MluNI TGGCCA 1 cut(s) 456
MmeI TCCRAC 1 cut(s) 862
Mox20I TGGCCA 1 cut(s) 456
MroXI GAANNNNTTC 1 cut(s) 872
MscI TGGCCA 1 cut(s) 456
MseI TTAA 2 cut(s) 567, 656
Msp20I TGGCCA 1 cut(s) 456
MspCI CTTAAG 1 cut(s) 655
Mva1269I GAATGC 1 cut(s) 534
MwoI GCNNNNNNNGC 2 cut(s) 671, 833
NcoI CCATGG 2 cut(s) 457, 811
NdeII GATC 1 cut(s) 493
NlaIII CATG 5 cut(s) 179, 461, 609, 815, 868
NlaIV GGNNCC 1 cut(s) 886
NmuCI GTSAC 1 cut(s) 699
NspI RCATGY 2 cut(s) 179, 609
PaeR7I CTCGAG 1 cut(s) 155
PciI ACATGT 1 cut(s) 175
PctI GAATGC 1 cut(s) 534
PdmI GAANNNNTTC 1 cut(s) 872
PkrI GCNGC 1 cut(s) 788
PscI ACATGT 1 cut(s) 175
PspN4I GGNNCC 1 cut(s) 886
PspPI GGNCC 8 cut(s) 89, 130, 227, 268, 344, 385, 461, 884
PstNI CAGNNNCTG 1 cut(s) 74
RsaI GTAC 2 cut(s) 503, 632
RsaNI GTAC 2 cut(s) 502, 631
SaqAI TTAA 2 cut(s) 567, 656
SatI GCNGC 1 cut(s) 787
Sau3AI GATC 1 cut(s) 493
Sau96I GGNCC 8 cut(s) 89, 130, 227, 268, 344, 385, 461, 884
SduI GDGCHC 1 cut(s) 829
SfaNI GCATC 1 cut(s) 661
Sfr274I CTCGAG 1 cut(s) 155
SinI GGWCC 4 cut(s) 130, 268, 385, 884
SlaI CTCGAG 1 cut(s) 155
SmlI CTYRAG 2 cut(s) 155, 655
SmoI CTYRAG 2 cut(s) 155, 655
Sse9I AATT 5 cut(s) 488, 579, 721, 769, 816
SsiI CCGC 2 cut(s) 263, 380
SspMI CTAG 1 cut(s) 921
StyI CCWWGG 2 cut(s) 457, 811
TaiI ACGT 1 cut(s) 66
TaqI TCGA 2 cut(s) 156, 765
TasI AATT 5 cut(s) 488, 579, 721, 769, 816
Tru1I TTAA 2 cut(s) 567, 656
Tru9I TTAA 2 cut(s) 567, 656
TscAI CASTG 1 cut(s) 783
TseFI GTSAC 1 cut(s) 699
TseI GCWGC 1 cut(s) 786
Tsp45I GTSAC 1 cut(s) 699
TspDTI ATGAA 2 cut(s) 36, 881
TspGWI ACGGA 1 cut(s) 519
TspRI CASTG 1 cut(s) 783
Vha464I CTTAAG 1 cut(s) 655
VpaK11BI GGWCC 4 cut(s) 130, 268, 385, 884
XceI RCATGY 2 cut(s) 179, 609
XcmI CCANNNNNNNNNTGG 1 cut(s) 818
XhoI CTCGAG 1 cut(s) 155
XmnI GAANNNNTTC 1 cut(s) 872
XspI CTAG 1 cut(s) 921
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.