Rmu_co8271811.1_g000001

Pollen proteins Ole e I like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8271811.1
Physical Location & Seq
Reverse (-)
2 .. 304
303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8271811.1_g000001.1.cds

Sequence Viewer

Length: 303 bp
atggctctcactcggttcctcctccccacctgtctggttttactttcattgctactcatcaacgtctcagctactgattatggctatggcccaaaaccaccacaggttgagcaaccaaaacctccacaggtccagaaaccagaaccaccacaggccgagaaaccaaaaccaccacaggttgagaaaccaacacctccacaggtctctgctagtgattatggctatggcccaaaaccaccacaggttgagcaaccaaaacctccgcaggttgagaaaccaaaaccaccacaggttgagaaacca
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

101

Amino Acids

11.09

Weight (kDa)

9.04

Isoelectric Point (pI)

38.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 256
AciI CCGC 1 cut(s) 263
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
Alw26I GTCTC 2 cut(s) 70, 208
AlwNI CAGNNNCTG 1 cut(s) 74
AoxI GGCC 3 cut(s) 88, 153, 226
AspS9I GGNCC 3 cut(s) 89, 130, 227
AvaII GGWCC 1 cut(s) 130
BcoDI GTCTC 2 cut(s) 70, 208
BfaI CTAG 1 cut(s) 210
BfuAI ACCTGC 1 cut(s) 256
Bme18I GGWCC 1 cut(s) 130
BmgT120I GGNCC 3 cut(s) 89, 130, 227
BmiI GGNNCC 1 cut(s) 17
BsaI GGTCTC 1 cut(s) 208
Bse3DI GCAATG 1 cut(s) 47
BseMI GCAATG 1 cut(s) 47
BseMII CTCAG 1 cut(s) 81
BseRI GAGGAG 1 cut(s) 11
BshFI GGCC 3 cut(s) 90, 155, 228
BsmAI GTCTC 2 cut(s) 70, 208
BsmBI CGTCTC 1 cut(s) 70
BsnI GGCC 3 cut(s) 90, 155, 228
Bso31I GGTCTC 1 cut(s) 208
BspACI CCGC 1 cut(s) 263
BspANI GGCC 3 cut(s) 90, 155, 228
BspCNI CTCAG 1 cut(s) 80
BspLI GGNNCC 1 cut(s) 17
BspMI ACCTGC 1 cut(s) 256
BspTNI GGTCTC 1 cut(s) 208
BsrDI GCAATG 1 cut(s) 47
BstDEI CTNAG 1 cut(s) 67
BstMAI GTCTC 2 cut(s) 70, 208
BstXI CCANNNNNNTGG 1 cut(s) 34
BsuRI GGCC 3 cut(s) 90, 155, 228
BveI ACCTGC 1 cut(s) 256
CaiI CAGNNNCTG 1 cut(s) 74
Cfr13I GGNCC 3 cut(s) 89, 130, 227
CviJI RGCY 7 cut(s) 5, 71, 84, 90, 155, 222, 228
CviKI_1 RGCY 7 cut(s) 5, 71, 84, 90, 155, 222, 228
DdeI CTNAG 1 cut(s) 67
Eco31I GGTCTC 1 cut(s) 208
Eco47I GGWCC 1 cut(s) 130
Esp3I CGTCTC 1 cut(s) 70
FaiI YATR 4 cut(s) 81, 87, 219, 225
FspBI CTAG 1 cut(s) 210
HaeIII GGCC 3 cut(s) 90, 155, 228
Hpy188III TCNNGA 1 cut(s) 133
HpyCH4IV ACGT 1 cut(s) 63
HpyF3I CTNAG 1 cut(s) 67
HpySE526I ACGT 1 cut(s) 63
MaeI CTAG 1 cut(s) 210
MaeII ACGT 1 cut(s) 63
MnlI CCTC 5 cut(s) 29, 32, 132, 204, 270
NlaIV GGNNCC 1 cut(s) 17
NmeAIII GCCGAG 1 cut(s) 181
PspN4I GGNNCC 1 cut(s) 17
PspPI GGNCC 3 cut(s) 89, 130, 227
PstNI CAGNNNCTG 1 cut(s) 74
Sau96I GGNCC 3 cut(s) 89, 130, 227
SinI GGWCC 1 cut(s) 130
SsiI CCGC 1 cut(s) 263
SspMI CTAG 1 cut(s) 210
TaiI ACGT 1 cut(s) 66
TspDTI ATGAA 1 cut(s) 36
VpaK11BI GGWCC 1 cut(s) 130
XspI CTAG 1 cut(s) 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.