Rmu_ssc0000248.1_g000013

Pollen proteins Ole e I like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000248.1
OG0008322
Physical Location & Seq
Forward (+)
63344 .. 64051
708 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000248.1_g000013.1.cds

Sequence Viewer

Length: 378 bp
atggctctcactcggttcctcctccccacctgtctggttttactttcattgctactcatcaacgtctcagctactgattatggctatggcccaaaaccaccacaggttgagcaaccaaaacctccgcaggttgagaaaccaaaaccaccacaggttgagaaaccaaaactagatcagttgtacggagagctactacctggcaatctgttcggcattcaagggcttgttttatgtaactcaggacttaaagccttcccaattcaagttggcctaatcaacaatgtaaaatgtattaaatgtcctctcaaggtgcataatattcctccaactgcccgagcaactacttccaagtttcaatgcatgaatgatgctggctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pollen_Ole_e_I

Protein Analysis

125

Amino Acids

13.59

Weight (kDa)

9.2

Isoelectric Point (pI)

25.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 118
AciI CCGC 1 cut(s) 125
AfaI GTAC 1 cut(s) 182
AgsI TTSAA 3 cut(s) 218, 263, 356
AjnI CCWGG 1 cut(s) 196
AluBI AGCT 2 cut(s) 71, 190
AluI AGCT 2 cut(s) 71, 190
Alw26I GTCTC 1 cut(s) 70
AlwNI CAGNNNCTG 1 cut(s) 74
Ama87I CYCGRG 1 cut(s) 333
AoxI GGCC 2 cut(s) 88, 268
AspS9I GGNCC 1 cut(s) 89
AvaI CYCGRG 1 cut(s) 333
BcgI CGANNNNNNTGC 2 cut(s) 190, 224
BciT130I CCWGG 1 cut(s) 198
BcoDI GTCTC 1 cut(s) 70
BfaI CTAG 2 cut(s) 170, 376
BfuAI ACCTGC 1 cut(s) 118
Bme1390I CCNGG 1 cut(s) 198
BmeT110I CYCGRG 1 cut(s) 333
BmgT120I GGNCC 1 cut(s) 89
BmiI GGNNCC 1 cut(s) 17
BmrFI CCNGG 1 cut(s) 198
BmsI GCATC 1 cut(s) 358
BpuEI CTTGAG 1 cut(s) 290
Bse3DI GCAATG 1 cut(s) 47
BseBI CCWGG 1 cut(s) 198
BseMI GCAATG 1 cut(s) 47
BseMII CTCAG 2 cut(s) 81, 252
BseRI GAGGAG 1 cut(s) 11
BshFI GGCC 2 cut(s) 90, 270
BsiHKCI CYCGRG 1 cut(s) 333
BsmAI GTCTC 1 cut(s) 70
BsmBI CGTCTC 1 cut(s) 70
BsmI GAATGC 1 cut(s) 213
BsnI GGCC 2 cut(s) 90, 270
BsoBI CYCGRG 1 cut(s) 333
Bsp143I GATC 1 cut(s) 172
BspACI CCGC 1 cut(s) 125
BspANI GGCC 2 cut(s) 90, 270
BspCNI CTCAG 2 cut(s) 80, 251
BspLI GGNNCC 1 cut(s) 17
BspMI ACCTGC 1 cut(s) 118
BsrDI GCAATG 1 cut(s) 47
BssMI GATC 1 cut(s) 172
Bst2UI CCWGG 1 cut(s) 198
BstC8I GCNNGC 1 cut(s) 373
BstDEI CTNAG 2 cut(s) 67, 238
BstKTI GATC 1 cut(s) 175
BstMAI GTCTC 1 cut(s) 70
BstMBI GATC 1 cut(s) 172
BstNI CCWGG 1 cut(s) 198
BstSCI CCNGG 1 cut(s) 196
BstXI CCANNNNNNTGG 1 cut(s) 34
BsuRI GGCC 2 cut(s) 90, 270
BveI ACCTGC 1 cut(s) 118
Cac8I GCNNGC 1 cut(s) 373
CaiI CAGNNNCTG 1 cut(s) 74
Cfr13I GGNCC 1 cut(s) 89
Csp6I GTAC 1 cut(s) 181
CviAII CATG 1 cut(s) 361
CviJI RGCY 9 cut(s) 5, 71, 84, 90, 190, 223, 251, 270, 375
CviKI_1 RGCY 9 cut(s) 5, 71, 84, 90, 190, 223, 251, 270, 375
CviQI GTAC 1 cut(s) 181
DdeI CTNAG 2 cut(s) 67, 238
DpnI GATC 1 cut(s) 174
DpnII GATC 1 cut(s) 172
Eco88I CYCGRG 1 cut(s) 333
EcoRII CCWGG 1 cut(s) 196
EcoT22I ATGCAT 1 cut(s) 362
Esp3I CGTCTC 1 cut(s) 70
FaeI CATG 1 cut(s) 364
FaiI YATR 5 cut(s) 81, 87, 232, 315, 362
FatI CATG 1 cut(s) 360
FspBI CTAG 2 cut(s) 170, 376
HaeIII GGCC 2 cut(s) 90, 270
Hin1II CATG 1 cut(s) 364
Hpy188III TCNNGA 1 cut(s) 240
HpyAV CCTTC 1 cut(s) 262
HpyCH4IV ACGT 1 cut(s) 63
HpyCH4V TGCA 2 cut(s) 313, 360
HpyF3I CTNAG 2 cut(s) 67, 238
HpySE526I ACGT 1 cut(s) 63
Hsp92II CATG 1 cut(s) 364
Kzo9I GATC 1 cut(s) 172
LpnPI CCDG 9 cut(s) 20, 43, 89, 113, 137, 183, 210, 225, 357
LweI GCATC 1 cut(s) 358
MaeI CTAG 2 cut(s) 170, 376
MaeII ACGT 1 cut(s) 63
MaeIII GTNAC 1 cut(s) 233
MalI GATC 1 cut(s) 174
MboI GATC 1 cut(s) 172
MluCI AATT 1 cut(s) 258
MmeI TCCRAC 1 cut(s) 350
MnlI CCTC 5 cut(s) 29, 32, 132, 312, 333
Mph1103I ATGCAT 1 cut(s) 362
MseI TTAA 2 cut(s) 246, 294
MspR9I CCNGG 1 cut(s) 198
Mva1269I GAATGC 1 cut(s) 213
MvaI CCWGG 1 cut(s) 198
NdeII GATC 1 cut(s) 172
NlaIII CATG 1 cut(s) 364
NlaIV GGNNCC 1 cut(s) 17
NsiI ATGCAT 1 cut(s) 362
PctI GAATGC 1 cut(s) 213
Psp6I CCWGG 1 cut(s) 196
PspGI CCWGG 1 cut(s) 196
PspN4I GGNNCC 1 cut(s) 17
PspPI GGNCC 1 cut(s) 89
PstNI CAGNNNCTG 1 cut(s) 74
RsaI GTAC 1 cut(s) 182
RsaNI GTAC 1 cut(s) 181
SaqAI TTAA 2 cut(s) 246, 294
Sau3AI GATC 1 cut(s) 172
Sau96I GGNCC 1 cut(s) 89
ScrFI CCNGG 1 cut(s) 198
SfaNI GCATC 1 cut(s) 358
SmlI CTYRAG 1 cut(s) 305
SmoI CTYRAG 1 cut(s) 305
Sse9I AATT 1 cut(s) 258
SsiI CCGC 1 cut(s) 125
SspI AATATT 1 cut(s) 319
SspMI CTAG 2 cut(s) 170, 376
StyD4I CCNGG 1 cut(s) 196
TaiI ACGT 1 cut(s) 66
TasI AATT 1 cut(s) 258
Tru1I TTAA 2 cut(s) 246, 294
Tru9I TTAA 2 cut(s) 246, 294
TspDTI ATGAA 2 cut(s) 36, 377
TspGWI ACGGA 1 cut(s) 198
XspI CTAG 2 cut(s) 170, 376
Zsp2I ATGCAT 1 cut(s) 362
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.