RchiOBHm_Chr7g0193751

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
12026791 .. 12027623
833 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ17326

Sequence Viewer

Length: 132 bp
ATGGGTTTCAAGATGCCAACTCCCCAGATGAATGCAGGTAAATCAATGGAGACTACAGCTGAGAAAGAAAACAAGGTAGATAAGGCTGGGGATTTGGCCCTCTTTGCTAAAGGAACATACAGAGTCAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

43

Amino Acids

4.71

Weight (kDa)

9.22

Isoelectric Point (pI)

16.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 26
AgsI TTSAA 1 cut(s) 10
AluBI AGCT 1 cut(s) 59
AluI AGCT 1 cut(s) 59
Alw26I GTCTC 1 cut(s) 44
AoxI GGCC 1 cut(s) 96
AspS9I GGNCC 1 cut(s) 97
BcoDI GTCTC 1 cut(s) 44
BfaI CTAG 1 cut(s) 130
BfmI CTRYAG 1 cut(s) 54
BfuAI ACCTGC 1 cut(s) 26
BmgT120I GGNCC 1 cut(s) 97
BmsI GCATC 1 cut(s) 3
BseMII CTCAG 1 cut(s) 51
BseYI CCCAGC 1 cut(s) 86
BshFI GGCC 1 cut(s) 98
BsmAI GTCTC 1 cut(s) 44
BsmI GAATGC 1 cut(s) 37
BsnI GGCC 1 cut(s) 98
BspANI GGCC 1 cut(s) 98
BspCNI CTCAG 1 cut(s) 52
BspMI ACCTGC 1 cut(s) 26
BstDEI CTNAG 1 cut(s) 60
BstMAI GTCTC 1 cut(s) 44
BstMWI GCNNNNNNNGC 1 cut(s) 104
BstSFI CTRYAG 1 cut(s) 54
BsuRI GGCC 1 cut(s) 98
BveI ACCTGC 1 cut(s) 26
Cfr13I GGNCC 1 cut(s) 97
CviJI RGCY 3 cut(s) 59, 86, 98
CviKI_1 RGCY 3 cut(s) 59, 86, 98
DdeI CTNAG 1 cut(s) 60
FaiI YATR 1 cut(s) 118
FspBI CTAG 1 cut(s) 130
GsaI CCCAGC 1 cut(s) 90
HaeIII GGCC 1 cut(s) 98
HincII GTYRAC 1 cut(s) 127
HindII GTYRAC 1 cut(s) 127
HinfI GANTC 1 cut(s) 123
Hpy166II GTNNAC 1 cut(s) 127
Hpy188III TCNNGA 1 cut(s) 10
Hpy8I GTNNAC 1 cut(s) 127
HpyCH4V TGCA 1 cut(s) 35
HpyF10VI GCNNNNNNNGC 1 cut(s) 104
HpyF3I CTNAG 1 cut(s) 60
LpnPI CCDG 3 cut(s) 21, 38, 72
LweI GCATC 1 cut(s) 3
MaeI CTAG 1 cut(s) 130
MlyI GAGTC 1 cut(s) 132
MnlI CCTC 1 cut(s) 110
MspA1I CMGCKG 1 cut(s) 59
Mva1269I GAATGC 1 cut(s) 37
MwoI GCNNNNNNNGC 1 cut(s) 104
PctI GAATGC 1 cut(s) 37
PleI GAGTC 1 cut(s) 131
PpsI GAGTC 1 cut(s) 131
PspFI CCCAGC 1 cut(s) 86
PspPI GGNCC 1 cut(s) 97
PvuII CAGCTG 1 cut(s) 59
Sau96I GGNCC 1 cut(s) 97
SchI GAGTC 1 cut(s) 132
SetI ASST 3 cut(s) 40, 61, 78
SfaNI GCATC 1 cut(s) 3
SfcI CTRYAG 1 cut(s) 54
SgeI CNNG 5 cut(s) 22, 37, 48, 85, 99
SspMI CTAG 1 cut(s) 130
TspDTI ATGAA 1 cut(s) 44
XspI CTAG 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.