Rh4BG096200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Reverse (-)
16421637 .. 16421985
349 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG096200.1

Sequence Viewer

Length: 207 bp
ATGCCCAAGCCGTTGATTGCTGACATTAGTTCTCGCACCTTTTTGATTTCCGCGATTCGGAATATCGATTGGAAGCGCAAGGAACAGATCGAGTTGAAGCGCCGTTATGGCAATTACAAGCCCCTAAAGAAACCGAGGTCGGCGGAGGTTGAAGCCGAGCAAAAGGAGCTCCAGGAGGCTATCAAAAATGCAAGACAAAGAGGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

8.04

Weight (kDa)

10.22

Isoelectric Point (pI)

64.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 53
AciI CCGC 2 cut(s) 51, 143
AfiI CCNNNNNNNGG 1 cut(s) 57
AgsI TTSAA 2 cut(s) 97, 152
AjnI CCWGG 1 cut(s) 171
AluBI AGCT 1 cut(s) 169
AluI AGCT 1 cut(s) 169
Alw21I GWGCWC 1 cut(s) 171
AspLEI GCGC 2 cut(s) 78, 102
BanII GRGCYC 1 cut(s) 171
Bbv12I GWGCWC 1 cut(s) 171
BceAI ACGGC 1 cut(s) 87
BciT130I CCWGG 1 cut(s) 173
BfaI CTAG 1 cut(s) 205
BfoI RGCGCY 1 cut(s) 103
BglI GCCNNNNNGGC 1 cut(s) 108
Bme1390I CCNGG 1 cut(s) 173
BmrFI CCNGG 1 cut(s) 173
BpmI CTGGAG 1 cut(s) 155
Bsa29I ATCGAT 1 cut(s) 66
BsaJI CCNNGG 1 cut(s) 134
Bsc4I CCNNNNNNNGG 1 cut(s) 57
BseBI CCWGG 1 cut(s) 173
BseCI ATCGAT 1 cut(s) 66
BseDI CCNNGG 1 cut(s) 134
BseLI CCNNNNNNNGG 1 cut(s) 57
Bsh1236I CGCG 1 cut(s) 53
BshVI ATCGAT 1 cut(s) 66
BsiHKAI GWGCWC 1 cut(s) 171
BslI CCNNNNNNNGG 1 cut(s) 57
Bsp1286I GDGCHC 1 cut(s) 171
Bsp143I GATC 1 cut(s) 87
BspACI CCGC 2 cut(s) 51, 143
BspDI ATCGAT 1 cut(s) 66
BspFNI CGCG 1 cut(s) 53
BssECI CCNNGG 1 cut(s) 134
BssMI GATC 1 cut(s) 87
Bst2UI CCWGG 1 cut(s) 173
BstFNI CGCG 1 cut(s) 53
BstH2I RGCGCY 1 cut(s) 103
BstHHI GCGC 2 cut(s) 78, 102
BstKTI GATC 1 cut(s) 90
BstMBI GATC 1 cut(s) 87
BstMWI GCNNNNNNNGC 2 cut(s) 108, 166
BstNI CCWGG 1 cut(s) 173
BstSCI CCNGG 1 cut(s) 171
BstUI CGCG 1 cut(s) 53
Bsu15I ATCGAT 1 cut(s) 66
BsuTUI ATCGAT 1 cut(s) 66
CfoI GCGC 2 cut(s) 78, 102
ClaI ATCGAT 1 cut(s) 66
CviJI RGCY 6 cut(s) 10, 121, 155, 169, 179, 204
CviKI_1 RGCY 6 cut(s) 10, 121, 155, 169, 179, 204
DpnI GATC 1 cut(s) 89
DpnII GATC 1 cut(s) 87
EciI GGCGGA 1 cut(s) 158
Ecl136II GAGCTC 1 cut(s) 169
Eco24I GRGCYC 1 cut(s) 171
Eco53kI GAGCTC 1 cut(s) 169
EcoICRI GAGCTC 1 cut(s) 169
EcoRII CCWGG 1 cut(s) 171
EcoT38I GRGCYC 1 cut(s) 171
FaiI YATR 1 cut(s) 108
FriOI GRGCYC 1 cut(s) 171
FspBI CTAG 1 cut(s) 205
GlaI GCGC 2 cut(s) 77, 101
GsuI CTGGAG 1 cut(s) 155
HaeII RGCGCY 1 cut(s) 103
HhaI GCGC 2 cut(s) 78, 102
Hin6I GCGC 2 cut(s) 76, 100
HinP1I GCGC 2 cut(s) 76, 100
HinfI GANTC 1 cut(s) 55
Hpy188I TCNGA 1 cut(s) 60
HpyCH4V TGCA 1 cut(s) 191
HpyF10VI GCNNNNNNNGC 2 cut(s) 108, 166
HspAI GCGC 2 cut(s) 76, 100
Kzo9I GATC 1 cut(s) 87
LmnI GCTCC 2 cut(s) 166, 174
LpnPI CCDG 2 cut(s) 158, 185
MaeI CTAG 1 cut(s) 205
MalI GATC 1 cut(s) 89
MboI GATC 1 cut(s) 87
MhlI GDGCHC 1 cut(s) 171
MluCI AATT 1 cut(s) 112
MnlI CCTC 4 cut(s) 129, 139, 169, 194
MspR9I CCNGG 1 cut(s) 173
MvaI CCWGG 1 cut(s) 173
MvnI CGCG 1 cut(s) 53
MwoI GCNNNNNNNGC 2 cut(s) 108, 166
NdeII GATC 1 cut(s) 87
NmeAIII GCCGAG 1 cut(s) 181
PfeI GAWTC 1 cut(s) 55
PfoI TCCNGGA 1 cut(s) 171
Psp124BI GAGCTC 1 cut(s) 171
Psp6I CCWGG 1 cut(s) 171
PspGI CCWGG 1 cut(s) 171
SacI GAGCTC 1 cut(s) 171
Sau3AI GATC 1 cut(s) 87
ScrFI CCNGG 1 cut(s) 173
SduI GDGCHC 1 cut(s) 171
SetI ASST 4 cut(s) 41, 140, 150, 171
Sse9I AATT 1 cut(s) 112
SsiI CCGC 2 cut(s) 51, 143
SspMI CTAG 1 cut(s) 205
SstI GAGCTC 1 cut(s) 171
StyD4I CCNGG 1 cut(s) 171
TaqI TCGA 2 cut(s) 66, 90
TasI AATT 1 cut(s) 112
TfiI GAWTC 1 cut(s) 55
XspI CTAG 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.