Rmu_sc0008822.1_g000007

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008822.1
OG0010603
Physical Location & Seq
Reverse (-)
29010 .. 29363
354 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008822.1_g000007.1.cds

Sequence Viewer

Length: 261 bp
atgcccaagccgttgattgctgagatttatggtttttgctctgctgggttttgttatctgcttcaatttgtgtcaaagaaaatgtcttttttgttgaaaagcgattcggaatatcgattggaagcgcaaggacagatcgagtggaagcgctgttatggcaagtacaagcccctaaagaaaccgaggtcggcggaggttgaagccaagcaaaaggagctccaggtggctatcaaaaatgcaagacaaagaggcttgaattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

9.98

Weight (kDa)

9.68

Isoelectric Point (pI)

41.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 191
AfaI GTAC 1 cut(s) 164
AfeI AGCGCT 1 cut(s) 149
AgsI TTSAA 4 cut(s) 65, 97, 200, 256
AjnI CCWGG 1 cut(s) 219
AluBI AGCT 1 cut(s) 217
AluI AGCT 1 cut(s) 217
Alw21I GWGCWC 1 cut(s) 219
Aor51HI AGCGCT 1 cut(s) 149
ArsI GACNNNNNNTTYG 2 cut(s) 68, 100
AspLEI GCGC 2 cut(s) 127, 150
BanII GRGCYC 1 cut(s) 219
Bbv12I GWGCWC 1 cut(s) 219
BciT130I CCWGG 1 cut(s) 221
BfoI RGCGCY 1 cut(s) 151
Bme1390I CCNGG 1 cut(s) 221
BmrFI CCNGG 1 cut(s) 221
BpmI CTGGAG 1 cut(s) 203
Bsa29I ATCGAT 1 cut(s) 115
BsaJI CCNNGG 1 cut(s) 182
BseBI CCWGG 1 cut(s) 221
BseCI ATCGAT 1 cut(s) 115
BseDI CCNNGG 1 cut(s) 182
BseMII CTCAG 1 cut(s) 12
BseYI CCCAGC 1 cut(s) 44
BshVI ATCGAT 1 cut(s) 115
BsiHKAI GWGCWC 1 cut(s) 219
Bsp1286I GDGCHC 1 cut(s) 219
Bsp143I GATC 1 cut(s) 135
BspACI CCGC 1 cut(s) 191
BspCNI CTCAG 1 cut(s) 13
BspDI ATCGAT 1 cut(s) 115
BssECI CCNNGG 1 cut(s) 182
BssMI GATC 1 cut(s) 135
Bst2UI CCWGG 1 cut(s) 221
BstDEI CTNAG 1 cut(s) 21
BstH2I RGCGCY 1 cut(s) 151
BstHHI GCGC 2 cut(s) 127, 150
BstKTI GATC 1 cut(s) 138
BstMBI GATC 1 cut(s) 135
BstMWI GCNNNNNNNGC 2 cut(s) 156, 214
BstNI CCWGG 1 cut(s) 221
BstSCI CCNGG 1 cut(s) 219
Bsu15I ATCGAT 1 cut(s) 115
BsuTUI ATCGAT 1 cut(s) 115
CfoI GCGC 2 cut(s) 127, 150
ClaI ATCGAT 1 cut(s) 115
Csp6I GTAC 1 cut(s) 163
CviJI RGCY 6 cut(s) 10, 169, 203, 217, 227, 252
CviKI_1 RGCY 6 cut(s) 10, 169, 203, 217, 227, 252
CviQI GTAC 1 cut(s) 163
DdeI CTNAG 1 cut(s) 21
DpnI GATC 1 cut(s) 137
DpnII GATC 1 cut(s) 135
EciI GGCGGA 1 cut(s) 206
Ecl136II GAGCTC 1 cut(s) 217
Eco24I GRGCYC 1 cut(s) 219
Eco47III AGCGCT 1 cut(s) 149
Eco53kI GAGCTC 1 cut(s) 217
EcoICRI GAGCTC 1 cut(s) 217
EcoRII CCWGG 1 cut(s) 219
EcoT38I GRGCYC 1 cut(s) 219
FaiI YATR 2 cut(s) 30, 156
FriOI GRGCYC 1 cut(s) 219
GlaI GCGC 2 cut(s) 126, 149
GsaI CCCAGC 1 cut(s) 48
GsuI CTGGAG 1 cut(s) 203
HaeII RGCGCY 1 cut(s) 151
HhaI GCGC 2 cut(s) 127, 150
Hin6I GCGC 2 cut(s) 125, 148
HinP1I GCGC 2 cut(s) 125, 148
HinfI GANTC 1 cut(s) 104
Hpy188I TCNGA 1 cut(s) 109
HpyCH4V TGCA 1 cut(s) 239
HpyF10VI GCNNNNNNNGC 2 cut(s) 156, 214
HpyF3I CTNAG 1 cut(s) 21
HspAI GCGC 2 cut(s) 125, 148
Kzo9I GATC 1 cut(s) 135
LmnI GCTCC 2 cut(s) 214, 222
LpnPI CCDG 3 cut(s) 30, 206, 233
MalI GATC 1 cut(s) 137
MboI GATC 1 cut(s) 135
MhlI GDGCHC 1 cut(s) 219
MluCI AATT 2 cut(s) 65, 256
MnlI CCTC 3 cut(s) 177, 187, 242
MspR9I CCNGG 1 cut(s) 221
MvaI CCWGG 1 cut(s) 221
MwoI GCNNNNNNNGC 2 cut(s) 156, 214
NdeII GATC 1 cut(s) 135
PfeI GAWTC 1 cut(s) 104
Psp124BI GAGCTC 1 cut(s) 219
Psp6I CCWGG 1 cut(s) 219
PspFI CCCAGC 1 cut(s) 44
PspGI CCWGG 1 cut(s) 219
RsaI GTAC 1 cut(s) 164
RsaNI GTAC 1 cut(s) 163
SacI GAGCTC 1 cut(s) 219
Sau3AI GATC 1 cut(s) 135
ScrFI CCNGG 1 cut(s) 221
SduI GDGCHC 1 cut(s) 219
SetI ASST 4 cut(s) 188, 198, 219, 225
Sse9I AATT 2 cut(s) 65, 256
SsiI CCGC 1 cut(s) 191
SstI GAGCTC 1 cut(s) 219
StyD4I CCNGG 1 cut(s) 219
TaqI TCGA 2 cut(s) 115, 138
TasI AATT 2 cut(s) 65, 256
TatI WGTACW 1 cut(s) 162
TfiI GAWTC 1 cut(s) 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.