RchiOBHm_Chr7g0202241

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
19886206 .. 19887003
798 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ18105

Sequence Viewer

Length: 195 bp
ATGGCCACCAAGAATAAAGGGACACATGATTTCAATCACTCTGTCTATGTAAATTCTAGTCGTCTCTCTCTCCTTTGTTATCTCCGCCATCATGGCTATGCACCATTTACTCAAGAACTCATGTGCTCGCTTGATTTCCAGTTTTCCACTATCGCAACTCTCTCAGTTCATCACTCTCGCTCATTCTTACCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.34

Weight (kDa)

8.77

Isoelectric Point (pI)

41.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 85
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 52
AgsI TTSAA 1 cut(s) 34
Alw21I GWGCWC 1 cut(s) 128
Alw26I GTCTC 1 cut(s) 68
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 1 cut(s) 52
BalI TGGCCA 1 cut(s) 5
Bbv12I GWGCWC 1 cut(s) 128
BccI CCATC 1 cut(s) 96
BcoDI GTCTC 1 cut(s) 68
BfaI CTAG 1 cut(s) 57
BglI GCCNNNNNGGC 1 cut(s) 93
BpuEI CTTGAG 1 cut(s) 96
BsaBI GATNNNNATC 1 cut(s) 33
Bse1I ACTGG 1 cut(s) 139
Bse8I GATNNNNATC 1 cut(s) 33
BseJI GATNNNNATC 1 cut(s) 33
BseMII CTCAG 1 cut(s) 177
BseNI ACTGG 1 cut(s) 139
BshFI GGCC 1 cut(s) 5
BsiHKAI GWGCWC 1 cut(s) 128
BslFI GGGAC 1 cut(s) 34
BsmAI GTCTC 1 cut(s) 68
BsmBI CGTCTC 1 cut(s) 68
BsmFI GGGAC 1 cut(s) 34
BsnI GGCC 1 cut(s) 5
Bsp1286I GDGCHC 1 cut(s) 128
BspACI CCGC 1 cut(s) 85
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 176
BsrI ACTGG 1 cut(s) 139
BstC8I GCNNGC 1 cut(s) 128
BstDEI CTNAG 1 cut(s) 163
BstMAI GTCTC 1 cut(s) 68
BstMWI GCNNNNNNNGC 1 cut(s) 93
BsuRI GGCC 1 cut(s) 5
Cac8I GCNNGC 1 cut(s) 128
CviAII CATG 4 cut(s) 26, 92, 121, 192
CviJI RGCY 2 cut(s) 5, 96
CviKI_1 RGCY 2 cut(s) 5, 96
DdeI CTNAG 1 cut(s) 163
EaeI YGGCCR 1 cut(s) 3
EciI GGCGGA 1 cut(s) 74
Esp3I CGTCTC 1 cut(s) 68
FaeI CATG 4 cut(s) 29, 95, 124, 195
FaiI YATR 6 cut(s) 27, 48, 93, 99, 122, 193
FaqI GGGAC 1 cut(s) 34
FatI CATG 4 cut(s) 25, 91, 120, 191
FspBI CTAG 1 cut(s) 57
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 4 cut(s) 29, 95, 124, 195
Hpy188III TCNNGA 1 cut(s) 113
HpyCH4V TGCA 1 cut(s) 101
HpyF10VI GCNNNNNNNGC 1 cut(s) 93
HpyF3I CTNAG 1 cut(s) 163
Hsp92II CATG 4 cut(s) 29, 95, 124, 195
LpnPI CCDG 1 cut(s) 152
MaeI CTAG 1 cut(s) 57
MhlI GDGCHC 1 cut(s) 128
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 1 cut(s) 52
MluNI TGGCCA 1 cut(s) 5
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MslI CAYNNNNRTG 1 cut(s) 96
Msp20I TGGCCA 1 cut(s) 5
MwoI GCNNNNNNNGC 1 cut(s) 93
NlaIII CATG 4 cut(s) 29, 95, 124, 195
RseI CAYNNNNRTG 1 cut(s) 96
SduI GDGCHC 1 cut(s) 128
SmiMI CAYNNNNRTG 1 cut(s) 96
SmlI CTYRAG 1 cut(s) 111
SmoI CTYRAG 1 cut(s) 111
Sse9I AATT 1 cut(s) 52
SsiI CCGC 1 cut(s) 85
SspMI CTAG 1 cut(s) 57
TasI AATT 1 cut(s) 52
TspDTI ATGAA 1 cut(s) 158
XapI RAATTY 1 cut(s) 52
XspI CTAG 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.