Rh1BG200400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Reverse (-)
31688265 .. 31700551
12287 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG200400.1

Sequence Viewer

Length: 156 bp
ATGTCTCACGCAAAAGAGACTGGATGTGAGCTTACGATAAGCGCCCATAAAAAGATTGTCAAGGAGCTGTACGCTGGGAAAAAGAAGAGTAAAAAATGGCTAAGAAGTGAGCACAATCGTACTTTTGCCGATTGGTTTCAATCCAAGATAACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.98

Weight (kDa)

9.93

Isoelectric Point (pI)

48.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 71, 121
AgsI TTSAA 1 cut(s) 140
AluBI AGCT 2 cut(s) 31, 67
AluI AGCT 2 cut(s) 31, 67
Alw21I GWGCWC 1 cut(s) 114
Alw26I GTCTC 2 cut(s) 9, 11
AspLEI GCGC 1 cut(s) 44
Bbv12I GWGCWC 1 cut(s) 114
BcoDI GTCTC 2 cut(s) 9, 11
BfoI RGCGCY 1 cut(s) 45
Bse1I ACTGG 1 cut(s) 25
BseGI GGATG 1 cut(s) 29
BseNI ACTGG 1 cut(s) 25
BseYI CCCAGC 1 cut(s) 74
BsiHKAI GWGCWC 1 cut(s) 114
BsmAI GTCTC 2 cut(s) 9, 11
Bsp1286I GDGCHC 1 cut(s) 114
BsrI ACTGG 1 cut(s) 25
Bst6I CTCTTC 1 cut(s) 80
BstDEI CTNAG 1 cut(s) 101
BstF5I GGATG 1 cut(s) 29
BstH2I RGCGCY 1 cut(s) 45
BstHHI GCGC 1 cut(s) 44
BstMAI GTCTC 2 cut(s) 9, 11
BtsCI GGATG 1 cut(s) 29
CfoI GCGC 1 cut(s) 44
Csp6I GTAC 2 cut(s) 70, 120
CviJI RGCY 3 cut(s) 31, 67, 100
CviKI_1 RGCY 3 cut(s) 31, 67, 100
CviQI GTAC 2 cut(s) 70, 120
DdeI CTNAG 1 cut(s) 101
Eam1104I CTCTTC 1 cut(s) 80
EarI CTCTTC 1 cut(s) 80
FaiI YATR 1 cut(s) 48
FokI GGATG 1 cut(s) 36
FspEI CC 9 cut(s) 6, 47, 58, 59, 60, 61, 82, 118, 142
GlaI GCGC 1 cut(s) 43
GsaI CCCAGC 1 cut(s) 78
HaeII RGCGCY 1 cut(s) 45
HhaI GCGC 1 cut(s) 44
Hin6I GCGC 1 cut(s) 42
HinP1I GCGC 1 cut(s) 42
HpyF3I CTNAG 1 cut(s) 101
HspAI GCGC 1 cut(s) 42
LmnI GCTCC 1 cut(s) 64
LpnPI CCDG 2 cut(s) 6, 60
MboII GAAGA 1 cut(s) 97
MhlI GDGCHC 1 cut(s) 114
PspFI CCCAGC 1 cut(s) 74
RsaI GTAC 2 cut(s) 71, 121
RsaNI GTAC 2 cut(s) 70, 120
SduI GDGCHC 1 cut(s) 114
SetI ASST 2 cut(s) 33, 69
SgeI CNNG 4 cut(s) 20, 33, 73, 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.