RchiOBHm_Chr7g0205881

U3 small nucleolar RNA-associated protein 18 homolog

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
23615700 .. 23616625
926 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ18422

Sequence Viewer

Length: 225 bp
ATGAGTTTAATATCACAAAACATTCCCGGCCACAAGACTAAGAGGATGGATGCTGATGAACCTTCATTTCTGCAAGGGAATGAAGACAATGGTGATGGAAAAGAATCTAATTTAGAGATCATGAGGATGACAAAGAGAAAGAAAGCACGCGACGGAGAGGATGAGAAGGTGGCAGTTGATCAAGAAAAGGAAACGAAGAAGCTGGAAAACTTTTTGTTTGGATGA

Protein Analysis

74

Amino Acids

8.46

Weight (kDa)

5.4

Isoelectric Point (pI)

44.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 150
AcoI YGGCCR 1 cut(s) 28
AluBI AGCT 1 cut(s) 202
AluI AGCT 1 cut(s) 202
AoxI GGCC 1 cut(s) 28
AsuC2I CCSGG 1 cut(s) 27
AsuHPI GGTGA 1 cut(s) 104
BbsI GAAGAC 1 cut(s) 90
BccI CCATC 2 cut(s) 40, 89
BclI TGATCA 1 cut(s) 178
BcnI CCSGG 1 cut(s) 27
Bme1390I CCNGG 1 cut(s) 27
BmrFI CCNGG 1 cut(s) 27
BmsI GCATC 1 cut(s) 40
BpiI GAAGAC 1 cut(s) 90
BpuMI CCSGG 1 cut(s) 27
BseGI GGATG 4 cut(s) 51, 55, 132, 166
Bsh1236I CGCG 1 cut(s) 150
BshFI GGCC 1 cut(s) 30
BsiSI CCGG 1 cut(s) 27
BsnI GGCC 1 cut(s) 30
Bsp143I GATC 2 cut(s) 117, 178
BspANI GGCC 1 cut(s) 30
BspFNI CGCG 1 cut(s) 150
BspHI TCATGA 1 cut(s) 120
BssMI GATC 2 cut(s) 117, 178
BstC8I GCNNGC 1 cut(s) 148
BstDEI CTNAG 1 cut(s) 39
BstF5I GGATG 4 cut(s) 51, 55, 132, 166
BstFNI CGCG 1 cut(s) 150
BstKTI GATC 2 cut(s) 120, 181
BstMBI GATC 2 cut(s) 117, 178
BstSCI CCNGG 1 cut(s) 25
BstUI CGCG 1 cut(s) 150
BstV2I GAAGAC 1 cut(s) 90
BsuRI GGCC 1 cut(s) 30
BtsCI GGATG 4 cut(s) 51, 55, 132, 166
Cac8I GCNNGC 1 cut(s) 148
CciI TCATGA 1 cut(s) 120
CviAII CATG 1 cut(s) 121
CviJI RGCY 2 cut(s) 30, 202
CviKI_1 RGCY 2 cut(s) 30, 202
DdeI CTNAG 1 cut(s) 39
DpnI GATC 2 cut(s) 119, 180
DpnII GATC 2 cut(s) 117, 178
EaeI YGGCCR 1 cut(s) 28
FaeI CATG 1 cut(s) 124
FaiI YATR 1 cut(s) 122
FatI CATG 1 cut(s) 120
FbaI TGATCA 1 cut(s) 178
FokI GGATG 4 cut(s) 58, 62, 139, 173
HaeIII GGCC 1 cut(s) 30
HapII CCGG 1 cut(s) 27
Hin1II CATG 1 cut(s) 124
HinfI GANTC 1 cut(s) 104
HpaII CCGG 1 cut(s) 27
HphI GGTGA 1 cut(s) 104
Hpy188III TCNNGA 2 cut(s) 121, 182
Hpy99I CGWCG 1 cut(s) 155
HpyAV CCTTC 2 cut(s) 72, 160
HpyCH4V TGCA 1 cut(s) 73
HpyF3I CTNAG 1 cut(s) 39
Hsp92II CATG 1 cut(s) 124
Ksp22I TGATCA 1 cut(s) 178
Kzo9I GATC 2 cut(s) 117, 178
LpnPI CCDG 2 cut(s) 40, 188
LweI GCATC 1 cut(s) 40
MalI GATC 2 cut(s) 119, 180
MboI GATC 2 cut(s) 117, 178
MboII GAAGA 2 cut(s) 95, 208
MluCI AATT 1 cut(s) 109
MnlI CCTC 3 cut(s) 36, 117, 151
MseI TTAA 1 cut(s) 8
MslI CAYNNNNRTG 1 cut(s) 125
MspI CCGG 1 cut(s) 27
MspR9I CCNGG 1 cut(s) 27
MvnI CGCG 1 cut(s) 150
NciI CCSGG 1 cut(s) 27
NdeII GATC 2 cut(s) 117, 178
NlaIII CATG 1 cut(s) 124
PagI TCATGA 1 cut(s) 120
PfeI GAWTC 1 cut(s) 104
RseI CAYNNNNRTG 1 cut(s) 125
SaqAI TTAA 1 cut(s) 8
Sau3AI GATC 2 cut(s) 117, 178
ScrFI CCNGG 1 cut(s) 27
SetI ASST 3 cut(s) 64, 171, 204
SfaNI GCATC 1 cut(s) 40
SgeI CNNG 9 cut(s) 38, 39, 46, 86, 133, 159, 161, 194, 215
SmiMI CAYNNNNRTG 1 cut(s) 125
Sse9I AATT 1 cut(s) 109
StyD4I CCNGG 1 cut(s) 25
TasI AATT 1 cut(s) 109
TfiI GAWTC 1 cut(s) 104
Tru1I TTAA 1 cut(s) 8
Tru9I TTAA 1 cut(s) 8
TspDTI ATGAA 3 cut(s) 54, 72, 96
TspGWI ACGGA 1 cut(s) 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.