RchiOBHm_Chr7g0213101

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
30250624 .. 30251721
1098 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19073

Sequence Viewer

Length: 234 bp
ATGGAGAACTATCATGATGGGATTGATATAGGAAACGATCTAGGTTCAATAGATTTTTATATTTTGTCCCAAATCTTAGACTGTCTTTTGGCTTTGTTTCATATTACTTACTCTGATCATGCTTCATGCTTGAACAATTTGGCTGGATATAAACAACTACTTGGCATTCTACGCATTATTTGTTGGTTGCTTCTTTGGTTTTGGAGAAGTTGCTTTATTATTTTTGGTAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.97

Weight (kDa)

5.26

Isoelectric Point (pI)

58.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 48, 133
BccI CCATC 1 cut(s) 11
BclI TGATCA 1 cut(s) 115
BfaI CTAG 1 cut(s) 41
BslFI GGGAC 1 cut(s) 52
BsmFI GGGAC 1 cut(s) 52
BsmI GAATGC 1 cut(s) 165
Bsp143I GATC 2 cut(s) 37, 115
BspHI TCATGA 1 cut(s) 13
BssMI GATC 2 cut(s) 37, 115
Bst4CI ACNGT 1 cut(s) 83
BstDEI CTNAG 1 cut(s) 76
BstKTI GATC 2 cut(s) 40, 118
BstMBI GATC 2 cut(s) 37, 115
BstMWI GCNNNNNNNGC 1 cut(s) 171
CciI TCATGA 1 cut(s) 13
CviAII CATG 3 cut(s) 14, 119, 126
CviJI RGCY 2 cut(s) 92, 143
CviKI_1 RGCY 2 cut(s) 92, 143
DdeI CTNAG 1 cut(s) 76
DpnI GATC 2 cut(s) 39, 117
DpnII GATC 2 cut(s) 37, 115
FaeI CATG 3 cut(s) 17, 122, 129
FaiI YATR 7 cut(s) 15, 29, 60, 102, 120, 127, 150
FaqI GGGAC 1 cut(s) 52
FatI CATG 3 cut(s) 13, 118, 125
FbaI TGATCA 1 cut(s) 115
FspBI CTAG 1 cut(s) 41
Hin1II CATG 3 cut(s) 17, 122, 129
Hpy188I TCNGA 1 cut(s) 115
Hpy188III TCNNGA 1 cut(s) 14
HpyCH4III ACNGT 1 cut(s) 83
HpyF10VI GCNNNNNNNGC 1 cut(s) 171
HpyF3I CTNAG 1 cut(s) 76
Hsp92II CATG 3 cut(s) 17, 122, 129
Ksp22I TGATCA 1 cut(s) 115
Kzo9I GATC 2 cut(s) 37, 115
LpnPI CCDG 1 cut(s) 129
MaeI CTAG 1 cut(s) 41
MalI GATC 2 cut(s) 39, 117
MboI GATC 2 cut(s) 37, 115
MluCI AATT 1 cut(s) 136
Mva1269I GAATGC 1 cut(s) 165
MwoI GCNNNNNNNGC 1 cut(s) 171
NdeII GATC 2 cut(s) 37, 115
NlaIII CATG 3 cut(s) 17, 122, 129
PagI TCATGA 1 cut(s) 13
PctI GAATGC 1 cut(s) 165
Sau3AI GATC 2 cut(s) 37, 115
SetI ASST 1 cut(s) 46
SgeI CNNG 7 cut(s) 26, 53, 131, 138, 142, 156, 173
Sse9I AATT 1 cut(s) 136
SspMI CTAG 1 cut(s) 41
TaaI ACNGT 1 cut(s) 83
TasI AATT 1 cut(s) 136
TspDTI ATGAA 2 cut(s) 89, 114
XspI CTAG 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.