Rh2CG542000

Pre-mRNA-splicing factor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
72072693 .. 72074409
1717 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG542000.1

Sequence Viewer

Length: 198 bp
ATGGAGAACTATCGTGAGGGGAGTGATGAAGAAAACGATCTAGGTTCAATAGATTTTGATATGCTGGTCCGAAATATTGAGAAATTCTCTCCAGGTTCCAATGGACGAATGACCACTTTGGGTGTGTATGTGCGTGACTTGCTACTTGGGCAGTCCCTTGCAATCACATATGCTGCTTTTCAGATTACAGTGGATTGA

Protein Analysis

65

Amino Acids

7.28

Weight (kDa)

4.26

Isoelectric Point (pI)

39.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 83
AgsI TTSAA 1 cut(s) 48
AjnI CCWGG 1 cut(s) 91
ApeKI GCWGC 1 cut(s) 173
ApoI RAATTY 1 cut(s) 83
AspS9I GGNCC 1 cut(s) 67
AvaII GGWCC 1 cut(s) 67
BbvI GCAGC 1 cut(s) 160
BciT130I CCWGG 1 cut(s) 93
BfaI CTAG 1 cut(s) 41
BisI GCNGC 1 cut(s) 174
BlsI GCNGC 1 cut(s) 175
Bme1390I CCNGG 1 cut(s) 93
Bme18I GGWCC 1 cut(s) 67
BmgT120I GGNCC 1 cut(s) 67
BmiI GGNNCC 1 cut(s) 97
BmrFI CCNGG 1 cut(s) 93
BplI GAGNNNNNCTC 2 cut(s) 71, 103
BpmI CTGGAG 1 cut(s) 75
BseBI CCWGG 1 cut(s) 93
BseXI GCAGC 1 cut(s) 160
BslFI GGGAC 1 cut(s) 139
BsmFI GGGAC 1 cut(s) 139
Bsp143I GATC 1 cut(s) 37
BspLI GGNNCC 1 cut(s) 97
BssMI GATC 1 cut(s) 37
Bst2UI CCWGG 1 cut(s) 93
Bst4CI ACNGT 1 cut(s) 190
BstKTI GATC 1 cut(s) 40
BstMBI GATC 1 cut(s) 37
BstMWI GCNNNNNNNGC 2 cut(s) 139, 148
BstNI CCWGG 1 cut(s) 93
BstSCI CCNGG 1 cut(s) 91
BstV1I GCAGC 1 cut(s) 160
BtsIMutI CAGTG 1 cut(s) 195
Cfr13I GGNCC 1 cut(s) 67
DpnI GATC 1 cut(s) 39
DpnII GATC 1 cut(s) 37
Eco47I GGWCC 1 cut(s) 67
EcoRII CCWGG 1 cut(s) 91
FaiI YATR 4 cut(s) 62, 129, 169, 171
FaqI GGGAC 1 cut(s) 139
FauNDI CATATG 1 cut(s) 169
Fnu4HI GCNGC 1 cut(s) 174
Fsp4HI GCNGC 1 cut(s) 174
FspBI CTAG 1 cut(s) 41
GluI GCNGC 1 cut(s) 174
GsuI CTGGAG 1 cut(s) 75
Hpy188I TCNGA 2 cut(s) 71, 183
Hpy188III TCNNGA 1 cut(s) 14
HpyCH4III ACNGT 1 cut(s) 190
HpyCH4V TGCA 1 cut(s) 161
HpyF10VI GCNNNNNNNGC 2 cut(s) 139, 148
Kzo9I GATC 1 cut(s) 37
LpnPI CCDG 3 cut(s) 50, 78, 105
Lsp1109I GCAGC 1 cut(s) 160
MaeI CTAG 1 cut(s) 41
MaeIII GTNAC 1 cut(s) 134
MalI GATC 1 cut(s) 39
MboI GATC 1 cut(s) 37
MboII GAAGA 1 cut(s) 41
MluCI AATT 1 cut(s) 83
MnlI CCTC 1 cut(s) 10
MspR9I CCNGG 1 cut(s) 93
MvaI CCWGG 1 cut(s) 93
MwoI GCNNNNNNNGC 2 cut(s) 139, 148
NdeI CATATG 1 cut(s) 169
NdeII GATC 1 cut(s) 37
NlaIV GGNNCC 1 cut(s) 97
NmuCI GTSAC 1 cut(s) 134
PkrI GCNGC 1 cut(s) 175
Psp6I CCWGG 1 cut(s) 91
PspGI CCWGG 1 cut(s) 91
PspN4I GGNNCC 1 cut(s) 97
PspPI GGNCC 1 cut(s) 67
SatI GCNGC 1 cut(s) 174
Sau3AI GATC 1 cut(s) 37
Sau96I GGNCC 1 cut(s) 67
ScrFI CCNGG 1 cut(s) 93
SetI ASST 2 cut(s) 46, 97
SgeI CNNG 9 cut(s) 26, 53, 77, 104, 105, 146, 151, 158, 170
SinI GGWCC 1 cut(s) 67
Sse9I AATT 1 cut(s) 83
SspI AATATT 1 cut(s) 76
SspMI CTAG 1 cut(s) 41
StyD4I CCNGG 1 cut(s) 91
TaaI ACNGT 1 cut(s) 190
TasI AATT 1 cut(s) 83
TscAI CASTG 1 cut(s) 195
TseFI GTSAC 1 cut(s) 134
TseI GCWGC 1 cut(s) 173
Tsp45I GTSAC 1 cut(s) 134
TspDTI ATGAA 1 cut(s) 42
TspRI CASTG 1 cut(s) 195
VpaK11BI GGWCC 1 cut(s) 67
XapI RAATTY 1 cut(s) 83
XspI CTAG 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.