RchiOBHm_Chr7g0226831

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
50194152 .. 50195106
955 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20313

Sequence Viewer

Length: 168 bp
ATGACGATATCAGCTATTCTCCTCCCTGTCGAATTGTGCGTATGGAACACCTTGGCAAGATTCTGGTTTCTTAATAGAACCAATAGCTCATGTACACAGAAGATGATACAAAAGTCTAGTTTTCCAGTGTTAACTGTCCTGGAACTATCAAGATCAAGATCATTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.33

Weight (kDa)

10.09

Isoelectric Point (pI)

69.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 94
AjnI CCWGG 1 cut(s) 138
AluBI AGCT 2 cut(s) 14, 87
AluI AGCT 2 cut(s) 14, 87
BaeI ACNNNNGTAYC 2 cut(s) 98, 131
BciT130I CCWGG 1 cut(s) 140
BfaI CTAG 1 cut(s) 117
Bme1390I CCNGG 1 cut(s) 140
BmrFI CCNGG 1 cut(s) 140
BsaBI GATNNNNATC 1 cut(s) 157
BsaJI CCNNGG 1 cut(s) 51
Bse1I ACTGG 1 cut(s) 125
Bse8I GATNNNNATC 1 cut(s) 157
BseBI CCWGG 1 cut(s) 140
BseDI CCNNGG 1 cut(s) 51
BseJI GATNNNNATC 1 cut(s) 157
BseNI ACTGG 1 cut(s) 125
BseRI GAGGAG 1 cut(s) 11
Bsp1407I TGTACA 1 cut(s) 92
Bsp143I GATC 2 cut(s) 152, 158
BsrGI TGTACA 1 cut(s) 92
BsrI ACTGG 1 cut(s) 125
BssECI CCNNGG 1 cut(s) 51
BssMI GATC 2 cut(s) 152, 158
BssT1I CCWWGG 1 cut(s) 51
Bst2UI CCWGG 1 cut(s) 140
Bst4CI ACNGT 1 cut(s) 136
BstAUI TGTACA 1 cut(s) 92
BstKTI GATC 2 cut(s) 155, 161
BstMBI GATC 2 cut(s) 152, 158
BstNI CCWGG 1 cut(s) 140
BstSCI CCNGG 1 cut(s) 138
BtsIMutI CAGTG 1 cut(s) 132
Csp6I GTAC 1 cut(s) 93
CviAII CATG 1 cut(s) 90
CviJI RGCY 2 cut(s) 14, 87
CviKI_1 RGCY 2 cut(s) 14, 87
CviQI GTAC 1 cut(s) 93
DpnI GATC 2 cut(s) 154, 160
DpnII GATC 2 cut(s) 152, 158
Eco130I CCWWGG 1 cut(s) 51
Eco32I GATATC 1 cut(s) 9
EcoRII CCWGG 1 cut(s) 138
EcoRV GATATC 1 cut(s) 9
EcoT14I CCWWGG 1 cut(s) 51
ErhI CCWWGG 1 cut(s) 51
FaeI CATG 1 cut(s) 93
FaiI YATR 3 cut(s) 43, 91, 166
FatI CATG 1 cut(s) 89
FspBI CTAG 1 cut(s) 117
Hin1II CATG 1 cut(s) 93
HincII GTYRAC 1 cut(s) 132
HindII GTYRAC 1 cut(s) 132
HinfI GANTC 1 cut(s) 60
HpaI GTTAAC 1 cut(s) 132
Hpy166II GTNNAC 2 cut(s) 95, 132
Hpy188III TCNNGA 2 cut(s) 150, 156
Hpy8I GTNNAC 2 cut(s) 95, 132
HpyCH4III ACNGT 1 cut(s) 136
Hsp92II CATG 1 cut(s) 93
KspAI GTTAAC 1 cut(s) 132
Kzo9I GATC 2 cut(s) 152, 158
LpnPI CCDG 5 cut(s) 39, 49, 125, 138, 152
MaeI CTAG 1 cut(s) 117
MalI GATC 2 cut(s) 154, 160
MboI GATC 2 cut(s) 152, 158
MboII GAAGA 1 cut(s) 112
MluCI AATT 1 cut(s) 32
MnlI CCTC 1 cut(s) 32
MseI TTAA 2 cut(s) 72, 131
MspR9I CCNGG 1 cut(s) 140
MvaI CCWGG 1 cut(s) 140
NdeII GATC 2 cut(s) 152, 158
NlaIII CATG 1 cut(s) 93
PcsI WCGNNNNNNNCGW 1 cut(s) 36
PfeI GAWTC 1 cut(s) 60
PfoI TCCNGGA 1 cut(s) 138
Psp6I CCWGG 1 cut(s) 138
PspGI CCWGG 1 cut(s) 138
RsaI GTAC 1 cut(s) 94
RsaNI GTAC 1 cut(s) 93
SaqAI TTAA 2 cut(s) 72, 131
Sau3AI GATC 2 cut(s) 152, 158
ScrFI CCNGG 1 cut(s) 140
SetI ASST 3 cut(s) 16, 53, 89
Sse9I AATT 1 cut(s) 32
SspMI CTAG 1 cut(s) 117
StyD4I CCNGG 1 cut(s) 138
StyI CCWWGG 1 cut(s) 51
TaaI ACNGT 1 cut(s) 136
TaqI TCGA 1 cut(s) 30
TasI AATT 1 cut(s) 32
TatI WGTACW 1 cut(s) 92
TfiI GAWTC 1 cut(s) 60
Tru1I TTAA 2 cut(s) 72, 131
Tru9I TTAA 2 cut(s) 72, 131
TscAI CASTG 1 cut(s) 132
TspRI CASTG 1 cut(s) 132
XspI CTAG 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.