Rroxscaffold_3G00237400

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
24997513 .. 24997938
426 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00237400.1

Sequence Viewer

Length: 342 bp
ATGGTGATCAGGATTGAAGATCTGAGGAAAAACGAGGCCAGGCTTTGTGGGTCTTTCTTGAAAATGGTTGAGGATGTGAAAGCCATGGCCAGCGACCCATCTGAGCAACAAGTGCTTCTGACCCAGATGGTTTTGAAGGAGTTGATGATGAATAGGAACAAACCAGAAGCAGCTTTCTCACTTGGTTTTCCCAAAAAGAAGAGATCTGGATCTAGAGGGATGCAAAAGCAGAATCAGAAGCAGAGGATCATCATCAAATTCAAACAGGATTTGAATTTGAAAACAGGATTTGAATTTGAAATTGAAATTGAAATTGAAGAGCAAGAAGAGGTGCTACTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

113

Amino Acids

13.19

Weight (kDa)

8.73

Isoelectric Point (pI)

68.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 217, 254
AcoI YGGCCR 1 cut(s) 87
AcsI RAATTY 3 cut(s) 257, 274, 293
AjnI CCWGG 1 cut(s) 38
AluBI AGCT 1 cut(s) 173
AluI AGCT 1 cut(s) 173
AlwI GGATC 2 cut(s) 217, 254
AoxI GGCC 2 cut(s) 36, 87
ApeKI GCWGC 1 cut(s) 170
ApoI RAATTY 3 cut(s) 257, 274, 293
AsuHPI GGTGA 1 cut(s) 16
BalI TGGCCA 1 cut(s) 89
BarI GAAGNNNNNNTAC 1 cut(s) 318
BbvI GCAGC 1 cut(s) 182
BccI CCATC 2 cut(s) 106, 121
BciT130I CCWGG 1 cut(s) 40
BclI TGATCA 1 cut(s) 6
BfaI CTAG 1 cut(s) 213
BglII AGATCT 2 cut(s) 19, 203
BisI GCNGC 1 cut(s) 171
BlsI GCNGC 1 cut(s) 172
Bme1390I CCNGG 1 cut(s) 40
BmrFI CCNGG 1 cut(s) 40
BmsI GCATC 1 cut(s) 210
BsaBI GATNNNNATC 2 cut(s) 208, 251
BsaJI CCNNGG 1 cut(s) 84
Bse8I GATNNNNATC 2 cut(s) 208, 251
BseBI CCWGG 1 cut(s) 40
BseDI CCNNGG 1 cut(s) 84
BseGI GGATG 2 cut(s) 79, 225
BseJI GATNNNNATC 2 cut(s) 208, 251
BseMII CTCAG 2 cut(s) 14, 93
BseXI GCAGC 1 cut(s) 182
BshFI GGCC 2 cut(s) 38, 89
BsnI GGCC 2 cut(s) 38, 89
Bsp143I GATC 5 cut(s) 6, 19, 203, 209, 246
Bsp19I CCATGG 1 cut(s) 84
BspANI GGCC 2 cut(s) 38, 89
BspCNI CTCAG 2 cut(s) 15, 94
BspPI GGATC 2 cut(s) 217, 254
BspQI GCTCTTC 1 cut(s) 312
BssECI CCNNGG 1 cut(s) 84
BssMI GATC 5 cut(s) 6, 19, 203, 209, 246
BssT1I CCWWGG 1 cut(s) 84
Bst2UI CCWGG 1 cut(s) 40
Bst6I CTCTTC 3 cut(s) 194, 312, 321
BstAPI GCANNNNNTGC 1 cut(s) 112
BstC8I GCNNGC 1 cut(s) 91
BstDEI CTNAG 2 cut(s) 23, 102
BstDSI CCRYGG 1 cut(s) 84
BstF5I GGATG 2 cut(s) 79, 225
BstKTI GATC 5 cut(s) 9, 22, 206, 212, 249
BstMBI GATC 5 cut(s) 6, 19, 203, 209, 246
BstMWI GCNNNNNNNGC 1 cut(s) 112
BstNI CCWGG 1 cut(s) 40
BstSCI CCNGG 1 cut(s) 38
BstV1I GCAGC 1 cut(s) 182
BstX2I RGATCY 3 cut(s) 19, 203, 209
BstYI RGATCY 3 cut(s) 19, 203, 209
BsuRI GGCC 2 cut(s) 38, 89
BtgI CCRYGG 1 cut(s) 84
BtsCI GGATG 2 cut(s) 79, 225
Cac8I GCNNGC 1 cut(s) 91
CviAII CATG 1 cut(s) 85
CviJI RGCY 5 cut(s) 38, 43, 83, 89, 173
CviKI_1 RGCY 5 cut(s) 38, 43, 83, 89, 173
DdeI CTNAG 2 cut(s) 23, 102
DpnI GATC 5 cut(s) 8, 21, 205, 211, 248
DpnII GATC 5 cut(s) 6, 19, 203, 209, 246
EaeI YGGCCR 1 cut(s) 87
Eam1104I CTCTTC 3 cut(s) 194, 312, 321
EarI CTCTTC 3 cut(s) 194, 312, 321
Eco130I CCWWGG 1 cut(s) 84
EcoRII CCWGG 1 cut(s) 38
EcoT14I CCWWGG 1 cut(s) 84
ErhI CCWWGG 1 cut(s) 84
FaeI CATG 1 cut(s) 88
FaiI YATR 1 cut(s) 86
FatI CATG 1 cut(s) 84
FbaI TGATCA 1 cut(s) 6
Fnu4HI GCNGC 1 cut(s) 171
FokI GGATG 2 cut(s) 86, 232
Fsp4HI GCNGC 1 cut(s) 171
FspBI CTAG 1 cut(s) 213
GluI GCNGC 1 cut(s) 171
HaeIII GGCC 2 cut(s) 38, 89
Hin1II CATG 1 cut(s) 88
HinfI GANTC 1 cut(s) 232
HphI GGTGA 1 cut(s) 16
Hpy188I TCNGA 5 cut(s) 24, 103, 120, 237, 341
Hpy188III TCNNGA 4 cut(s) 10, 58, 207, 213
HpyAV CCTTC 1 cut(s) 130
HpyCH4V TGCA 1 cut(s) 223
HpyF10VI GCNNNNNNNGC 1 cut(s) 112
HpyF3I CTNAG 2 cut(s) 23, 102
Hsp92II CATG 1 cut(s) 88
Ksp22I TGATCA 1 cut(s) 6
Kzo9I GATC 5 cut(s) 6, 19, 203, 209, 246
LguI GCTCTTC 1 cut(s) 312
LpnPI CCDG 8 cut(s) 25, 52, 103, 137, 177, 192, 251, 270
Lsp1109I GCAGC 1 cut(s) 182
LweI GCATC 1 cut(s) 210
MaeI CTAG 1 cut(s) 213
MalI GATC 5 cut(s) 8, 21, 205, 211, 248
MboI GATC 5 cut(s) 6, 19, 203, 209, 246
MboII GAAGA 4 cut(s) 29, 211, 329, 338
MflI RGATCY 3 cut(s) 19, 203, 209
MlsI TGGCCA 1 cut(s) 89
MluCI AATT 6 cut(s) 257, 274, 293, 300, 306, 312
MluNI TGGCCA 1 cut(s) 89
MnlI CCTC 6 cut(s) 18, 28, 64, 209, 237, 322
Mox20I TGGCCA 1 cut(s) 89
MscI TGGCCA 1 cut(s) 89
Msp20I TGGCCA 1 cut(s) 89
MspR9I CCNGG 1 cut(s) 40
MvaI CCWGG 1 cut(s) 40
MwoI GCNNNNNNNGC 1 cut(s) 112
NcoI CCATGG 1 cut(s) 84
NdeII GATC 5 cut(s) 6, 19, 203, 209, 246
NlaIII CATG 1 cut(s) 88
PciSI GCTCTTC 1 cut(s) 312
PfeI GAWTC 1 cut(s) 232
PkrI GCNGC 1 cut(s) 172
Psp6I CCWGG 1 cut(s) 38
PspGI CCWGG 1 cut(s) 38
PsuI RGATCY 3 cut(s) 19, 203, 209
SapI GCTCTTC 1 cut(s) 312
SatI GCNGC 1 cut(s) 171
Sau3AI GATC 5 cut(s) 6, 19, 203, 209, 246
ScrFI CCNGG 1 cut(s) 40
SetI ASST 2 cut(s) 175, 333
SfaNI GCATC 1 cut(s) 210
Sse9I AATT 6 cut(s) 257, 274, 293, 300, 306, 312
SspMI CTAG 1 cut(s) 213
StyD4I CCNGG 1 cut(s) 38
StyI CCWWGG 1 cut(s) 84
TasI AATT 6 cut(s) 257, 274, 293, 300, 306, 312
TfiI GAWTC 1 cut(s) 232
TseI GCWGC 1 cut(s) 170
TspDTI ATGAA 1 cut(s) 164
XapI RAATTY 3 cut(s) 257, 274, 293
XbaI TCTAGA 1 cut(s) 212
XspI CTAG 1 cut(s) 213
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.