RLG00000001692

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
Physical Location & Seq
Forward (+)
19196854 .. 19197570
717 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000001692

Sequence Viewer

Length: 612 bp
ATGGTGATCAGGATTGAAGATTTGAGGAAAAATGAGACCAGGCTTTGTGGGTCTTTCTTGAAAATGGTTGATGATGTGAAAGCCATGACCAGCGACCCATCTGAGCAACAAGTGCTTCTGACCCAGATGGTTTTGAAGGAGTTGATGATGAATAGGAACAAACCAGAAGCAGCATTCTCACTTGGTTTTCCCAAAAAGAAGAGATCTGGATCTAGAGGGATGCAAAAGCAGAATCAGAGGCAGAGGATCATTATCAAATTCAAACGCTGCGTCTCTGCCACTACAGGTACTGCTTCTTATTCTTGTTCTGTTTCCCCTGATTCTGGTTTTGTTGTAAACCCAGACCCACTTCATGATGATCACAAACAGGATTTGAAATTGAAATTGAAATTGAAGAGCAAGAAGAGGTGCTACTCTGAAATCGAACAAGCAGGCGATGAAGGTTTCAAAGAAATAAACTCGAAAAGGCTGAGAAAGGGAAAGAATGATAAGAGGGTATTACCAAGTGTGCAATCGATGACTGTGGATTTTCCAAAGGAAGAATTGCAGGATCGTATTGGTGGATCAGATCACCCAAAGCCAACAGCAAGAGCAATATCAAGAGCAATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

204

Amino Acids

23.02

Weight (kDa)

9.86

Isoelectric Point (pI)

47.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 4 cut(s) 217, 254, 558, 571
AcsI RAATTY 1 cut(s) 257
AfaI GTAC 1 cut(s) 289
AfiI CCNNNNNNNGG 1 cut(s) 323
AgsI TTSAA 9 cut(s) 17, 61, 136, 262, 376, 382, 388, 394, 448
AjnI CCWGG 1 cut(s) 38
Alw26I GTCTC 2 cut(s) 29, 277
AlwI GGATC 4 cut(s) 217, 254, 558, 571
AlwNI CAGNNNCTG 1 cut(s) 290
ApeKI GCWGC 2 cut(s) 170, 267
ApoI RAATTY 1 cut(s) 257
ArsI GACNNNNNNTTYG 2 cut(s) 255, 287
AsuHPI GGTGA 2 cut(s) 16, 563
BarI GAAGNNNNNNTAC 2 cut(s) 395, 427
BbvI GCAGC 2 cut(s) 182, 254
BccI CCATC 2 cut(s) 106, 121
BciT130I CCWGG 1 cut(s) 40
BclI TGATCA 2 cut(s) 6, 358
BcoDI GTCTC 2 cut(s) 29, 277
BfaI CTAG 1 cut(s) 213
BfmI CTRYAG 1 cut(s) 282
BglII AGATCT 1 cut(s) 203
BisI GCNGC 2 cut(s) 171, 268
BlsI GCNGC 2 cut(s) 172, 269
Bme1390I CCNGG 1 cut(s) 40
BmrFI CCNGG 1 cut(s) 40
BmsI GCATC 1 cut(s) 210
Bsa29I ATCGAT 1 cut(s) 515
BsaBI GATNNNNATC 2 cut(s) 208, 251
BsaI GGTCTC 1 cut(s) 29
Bsc4I CCNNNNNNNGG 1 cut(s) 323
Bse8I GATNNNNATC 2 cut(s) 208, 251
BseBI CCWGG 1 cut(s) 40
BseCI ATCGAT 1 cut(s) 515
BseGI GGATG 1 cut(s) 225
BseJI GATNNNNATC 2 cut(s) 208, 251
BseLI CCNNNNNNNGG 1 cut(s) 323
BseMII CTCAG 2 cut(s) 93, 461
BseXI GCAGC 2 cut(s) 182, 254
BshVI ATCGAT 1 cut(s) 515
BslI CCNNNNNNNGG 1 cut(s) 323
BsmAI GTCTC 2 cut(s) 29, 277
BsmBI CGTCTC 1 cut(s) 277
BsmI GAATGC 1 cut(s) 173
Bso31I GGTCTC 1 cut(s) 29
Bsp143I GATC 8 cut(s) 6, 203, 209, 246, 358, 550, 563, 568
BspCNI CTCAG 2 cut(s) 94, 462
BspDI ATCGAT 1 cut(s) 515
BspHI TCATGA 1 cut(s) 352
BspPI GGATC 4 cut(s) 217, 254, 558, 571
BspQI GCTCTTC 1 cut(s) 389
BspTNI GGTCTC 1 cut(s) 29
BssMI GATC 8 cut(s) 6, 203, 209, 246, 358, 550, 563, 568
Bst2UI CCWGG 1 cut(s) 40
Bst4CI ACNGT 1 cut(s) 523
Bst6I CTCTTC 3 cut(s) 194, 389, 398
BstAPI GCANNNNNTGC 1 cut(s) 112
BstC8I GCNNGC 1 cut(s) 433
BstDEI CTNAG 2 cut(s) 102, 470
BstF5I GGATG 1 cut(s) 225
BstKTI GATC 8 cut(s) 9, 206, 212, 249, 361, 553, 566, 571
BstMAI GTCTC 2 cut(s) 29, 277
BstMBI GATC 8 cut(s) 6, 203, 209, 246, 358, 550, 563, 568
BstMWI GCNNNNNNNGC 1 cut(s) 112
BstNI CCWGG 1 cut(s) 40
BstSCI CCNGG 1 cut(s) 38
BstSFI CTRYAG 1 cut(s) 282
BstV1I GCAGC 2 cut(s) 182, 254
BstX2I RGATCY 2 cut(s) 203, 209
BstYI RGATCY 2 cut(s) 203, 209
Bsu15I ATCGAT 1 cut(s) 515
BsuTUI ATCGAT 1 cut(s) 515
BtgZI GCGATG 1 cut(s) 450
BtsCI GGATG 1 cut(s) 225
Cac8I GCNNGC 1 cut(s) 433
CaiI CAGNNNCTG 1 cut(s) 290
CciI TCATGA 1 cut(s) 352
ClaI ATCGAT 1 cut(s) 515
CseI GACGC 1 cut(s) 259
Csp6I GTAC 1 cut(s) 288
CviAII CATG 2 cut(s) 85, 353
CviJI RGCY 4 cut(s) 43, 83, 469, 580
CviKI_1 RGCY 4 cut(s) 43, 83, 469, 580
CviQI GTAC 1 cut(s) 288
DdeI CTNAG 2 cut(s) 102, 470
DpnI GATC 8 cut(s) 8, 205, 211, 248, 360, 552, 565, 570
DpnII GATC 8 cut(s) 6, 203, 209, 246, 358, 550, 563, 568
Eam1104I CTCTTC 3 cut(s) 194, 389, 398
EarI CTCTTC 3 cut(s) 194, 389, 398
Eco31I GGTCTC 1 cut(s) 29
EcoRII CCWGG 1 cut(s) 38
Esp3I CGTCTC 1 cut(s) 277
FaeI CATG 2 cut(s) 88, 356
FaiI YATR 3 cut(s) 86, 354, 610
FatI CATG 2 cut(s) 84, 352
FbaI TGATCA 2 cut(s) 6, 358
Fnu4HI GCNGC 2 cut(s) 171, 268
FokI GGATG 1 cut(s) 232
Fsp4HI GCNGC 2 cut(s) 171, 268
FspBI CTAG 1 cut(s) 213
GluI GCNGC 2 cut(s) 171, 268
HgaI GACGC 1 cut(s) 259
Hin1II CATG 2 cut(s) 88, 356
HinfI GANTC 2 cut(s) 232, 320
HphI GGTGA 2 cut(s) 16, 563
Hpy166II GTNNAC 1 cut(s) 337
Hpy188I TCNGA 5 cut(s) 103, 120, 237, 418, 568
Hpy188III TCNNGA 6 cut(s) 10, 58, 207, 213, 353, 600
Hpy8I GTNNAC 1 cut(s) 337
HpyAV CCTTC 2 cut(s) 130, 434
HpyCH4III ACNGT 1 cut(s) 523
HpyCH4V TGCA 3 cut(s) 223, 511, 547
HpyF10VI GCNNNNNNNGC 1 cut(s) 112
HpyF3I CTNAG 2 cut(s) 102, 470
Hsp92II CATG 2 cut(s) 88, 356
Ksp22I TGATCA 2 cut(s) 6, 358
Kzo9I GATC 8 cut(s) 6, 203, 209, 246, 358, 550, 563, 568
LguI GCTCTTC 1 cut(s) 389
Lsp1109I GCAGC 2 cut(s) 182, 254
LweI GCATC 1 cut(s) 210
MaeI CTAG 1 cut(s) 213
MalI GATC 8 cut(s) 8, 205, 211, 248, 360, 552, 565, 570
MboI GATC 8 cut(s) 6, 203, 209, 246, 358, 550, 563, 568
MboII GAAGA 5 cut(s) 29, 211, 406, 415, 551
MflI RGATCY 2 cut(s) 203, 209
MluCI AATT 5 cut(s) 257, 377, 383, 389, 542
MnlI CCTC 6 cut(s) 18, 209, 231, 237, 399, 486
MspR9I CCNGG 1 cut(s) 40
Mva1269I GAATGC 1 cut(s) 173
MvaI CCWGG 1 cut(s) 40
MwoI GCNNNNNNNGC 1 cut(s) 112
NdeII GATC 8 cut(s) 6, 203, 209, 246, 358, 550, 563, 568
NlaIII CATG 2 cut(s) 88, 356
PagI TCATGA 1 cut(s) 352
PciSI GCTCTTC 1 cut(s) 389
PctI GAATGC 1 cut(s) 173
PfeI GAWTC 2 cut(s) 232, 320
PkrI GCNGC 2 cut(s) 172, 269
Psp6I CCWGG 1 cut(s) 38
PspGI CCWGG 1 cut(s) 38
PstNI CAGNNNCTG 1 cut(s) 290
PsuI RGATCY 2 cut(s) 203, 209
RsaI GTAC 1 cut(s) 289
RsaNI GTAC 1 cut(s) 288
SapI GCTCTTC 1 cut(s) 389
SatI GCNGC 2 cut(s) 171, 268
Sau3AI GATC 8 cut(s) 6, 203, 209, 246, 358, 550, 563, 568
ScrFI CCNGG 1 cut(s) 40
SetI ASST 3 cut(s) 289, 410, 445
SfaNI GCATC 1 cut(s) 210
SfcI CTRYAG 1 cut(s) 282
Sse9I AATT 5 cut(s) 257, 377, 383, 389, 542
SspMI CTAG 1 cut(s) 213
StyD4I CCNGG 1 cut(s) 38
TaaI ACNGT 1 cut(s) 523
TaqI TCGA 3 cut(s) 423, 461, 515
TasI AATT 5 cut(s) 257, 377, 383, 389, 542
TfiI GAWTC 2 cut(s) 232, 320
TseI GCWGC 2 cut(s) 170, 267
TspDTI ATGAA 3 cut(s) 164, 341, 453
XapI RAATTY 1 cut(s) 257
XbaI TCTAGA 1 cut(s) 212
XspI CTAG 1 cut(s) 213
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.